ID: 1198087179

View in Genome Browser
Species Human (GRCh38)
Location X:133292731-133292753
Sequence CTCCTGCAGTGGGCACAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198087179_1198087188 -4 Left 1198087179 X:133292731-133292753 CCAACCTGTGCCCACTGCAGGAG No data
Right 1198087188 X:133292750-133292772 GGAGGTGGGGCTCAGTGGCCAGG No data
1198087179_1198087187 -9 Left 1198087179 X:133292731-133292753 CCAACCTGTGCCCACTGCAGGAG No data
Right 1198087187 X:133292745-133292767 CTGCAGGAGGTGGGGCTCAGTGG No data
1198087179_1198087191 28 Left 1198087179 X:133292731-133292753 CCAACCTGTGCCCACTGCAGGAG No data
Right 1198087191 X:133292782-133292804 TGCAGCTAGCCCTCATCCAAGGG No data
1198087179_1198087190 27 Left 1198087179 X:133292731-133292753 CCAACCTGTGCCCACTGCAGGAG No data
Right 1198087190 X:133292781-133292803 ATGCAGCTAGCCCTCATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198087179 Original CRISPR CTCCTGCAGTGGGCACAGGT TGG (reversed) Intergenic
No off target data available for this crispr