ID: 1198087438

View in Genome Browser
Species Human (GRCh38)
Location X:133294190-133294212
Sequence CTCAGAGCTCGTGATTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198087435_1198087438 -4 Left 1198087435 X:133294171-133294193 CCCTTGACCTGCAAGACAGCTCA No data
Right 1198087438 X:133294190-133294212 CTCAGAGCTCGTGATTTCACTGG No data
1198087429_1198087438 24 Left 1198087429 X:133294143-133294165 CCCTGAACTTTCCAATGTGCACC No data
Right 1198087438 X:133294190-133294212 CTCAGAGCTCGTGATTTCACTGG No data
1198087431_1198087438 13 Left 1198087431 X:133294154-133294176 CCAATGTGCACCCCTCTCCCTTG No data
Right 1198087438 X:133294190-133294212 CTCAGAGCTCGTGATTTCACTGG No data
1198087432_1198087438 3 Left 1198087432 X:133294164-133294186 CCCCTCTCCCTTGACCTGCAAGA No data
Right 1198087438 X:133294190-133294212 CTCAGAGCTCGTGATTTCACTGG No data
1198087430_1198087438 23 Left 1198087430 X:133294144-133294166 CCTGAACTTTCCAATGTGCACCC No data
Right 1198087438 X:133294190-133294212 CTCAGAGCTCGTGATTTCACTGG No data
1198087433_1198087438 2 Left 1198087433 X:133294165-133294187 CCCTCTCCCTTGACCTGCAAGAC No data
Right 1198087438 X:133294190-133294212 CTCAGAGCTCGTGATTTCACTGG No data
1198087436_1198087438 -5 Left 1198087436 X:133294172-133294194 CCTTGACCTGCAAGACAGCTCAG No data
Right 1198087438 X:133294190-133294212 CTCAGAGCTCGTGATTTCACTGG No data
1198087434_1198087438 1 Left 1198087434 X:133294166-133294188 CCTCTCCCTTGACCTGCAAGACA No data
Right 1198087438 X:133294190-133294212 CTCAGAGCTCGTGATTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198087438 Original CRISPR CTCAGAGCTCGTGATTTCAC TGG Intergenic
No off target data available for this crispr