ID: 1198087824

View in Genome Browser
Species Human (GRCh38)
Location X:133297001-133297023
Sequence CAGGCAGATCACTTGATGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182006
Summary {0: 67, 1: 5676, 2: 23481, 3: 54304, 4: 98478}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198087824_1198087827 -1 Left 1198087824 X:133297001-133297023 CCTGACATCAAGTGATCTGCCTG 0: 67
1: 5676
2: 23481
3: 54304
4: 98478
Right 1198087827 X:133297023-133297045 GCCTCGGCCTCCCAAAATGTTGG 0: 277
1: 8876
2: 111351
3: 237256
4: 230803
1198087824_1198087832 22 Left 1198087824 X:133297001-133297023 CCTGACATCAAGTGATCTGCCTG 0: 67
1: 5676
2: 23481
3: 54304
4: 98478
Right 1198087832 X:133297046-133297068 TATCACATGTGTCAGCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198087824 Original CRISPR CAGGCAGATCACTTGATGTC AGG (reversed) Intergenic
Too many off-targets to display for this crispr