ID: 1198087826

View in Genome Browser
Species Human (GRCh38)
Location X:133297020-133297042
Sequence ACATTTTGGGAGGCCGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 620753
Summary {0: 290, 1: 9503, 2: 116550, 3: 251095, 4: 243315}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198087826_1198087832 3 Left 1198087826 X:133297020-133297042 CCTGCCTCGGCCTCCCAAAATGT 0: 290
1: 9503
2: 116550
3: 251095
4: 243315
Right 1198087832 X:133297046-133297068 TATCACATGTGTCAGCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198087826 Original CRISPR ACATTTTGGGAGGCCGAGGC AGG (reversed) Intergenic
Too many off-targets to display for this crispr