ID: 1198087828

View in Genome Browser
Species Human (GRCh38)
Location X:133297024-133297046
Sequence ACCAACATTTTGGGAGGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 477671
Summary {0: 6, 1: 566, 2: 15082, 3: 163514, 4: 298503}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198087828_1198087839 28 Left 1198087828 X:133297024-133297046 CCTCGGCCTCCCAAAATGTTGGT 0: 6
1: 566
2: 15082
3: 163514
4: 298503
Right 1198087839 X:133297075-133297097 CCCTGCCTCGCTTCTCAGTCAGG No data
1198087828_1198087832 -1 Left 1198087828 X:133297024-133297046 CCTCGGCCTCCCAAAATGTTGGT 0: 6
1: 566
2: 15082
3: 163514
4: 298503
Right 1198087832 X:133297046-133297068 TATCACATGTGTCAGCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198087828 Original CRISPR ACCAACATTTTGGGAGGCCG AGG (reversed) Intergenic
Too many off-targets to display for this crispr