ID: 1198087830

View in Genome Browser
Species Human (GRCh38)
Location X:133297033-133297055
Sequence ACATGTGATACCAACATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198087830_1198087832 -10 Left 1198087830 X:133297033-133297055 CCCAAAATGTTGGTATCACATGT No data
Right 1198087832 X:133297046-133297068 TATCACATGTGTCAGCCACCAGG No data
1198087830_1198087839 19 Left 1198087830 X:133297033-133297055 CCCAAAATGTTGGTATCACATGT No data
Right 1198087839 X:133297075-133297097 CCCTGCCTCGCTTCTCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198087830 Original CRISPR ACATGTGATACCAACATTTT GGG (reversed) Intergenic
No off target data available for this crispr