ID: 1198087832

View in Genome Browser
Species Human (GRCh38)
Location X:133297046-133297068
Sequence TATCACATGTGTCAGCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198087826_1198087832 3 Left 1198087826 X:133297020-133297042 CCTGCCTCGGCCTCCCAAAATGT 0: 290
1: 9503
2: 116550
3: 251095
4: 243315
Right 1198087832 X:133297046-133297068 TATCACATGTGTCAGCCACCAGG No data
1198087829_1198087832 -7 Left 1198087829 X:133297030-133297052 CCTCCCAAAATGTTGGTATCACA No data
Right 1198087832 X:133297046-133297068 TATCACATGTGTCAGCCACCAGG No data
1198087824_1198087832 22 Left 1198087824 X:133297001-133297023 CCTGACATCAAGTGATCTGCCTG 0: 67
1: 5676
2: 23481
3: 54304
4: 98478
Right 1198087832 X:133297046-133297068 TATCACATGTGTCAGCCACCAGG No data
1198087830_1198087832 -10 Left 1198087830 X:133297033-133297055 CCCAAAATGTTGGTATCACATGT No data
Right 1198087832 X:133297046-133297068 TATCACATGTGTCAGCCACCAGG No data
1198087828_1198087832 -1 Left 1198087828 X:133297024-133297046 CCTCGGCCTCCCAAAATGTTGGT 0: 6
1: 566
2: 15082
3: 163514
4: 298503
Right 1198087832 X:133297046-133297068 TATCACATGTGTCAGCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198087832 Original CRISPR TATCACATGTGTCAGCCACC AGG Intergenic
No off target data available for this crispr