ID: 1198087839

View in Genome Browser
Species Human (GRCh38)
Location X:133297075-133297097
Sequence CCCTGCCTCGCTTCTCAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198087830_1198087839 19 Left 1198087830 X:133297033-133297055 CCCAAAATGTTGGTATCACATGT No data
Right 1198087839 X:133297075-133297097 CCCTGCCTCGCTTCTCAGTCAGG No data
1198087829_1198087839 22 Left 1198087829 X:133297030-133297052 CCTCCCAAAATGTTGGTATCACA No data
Right 1198087839 X:133297075-133297097 CCCTGCCTCGCTTCTCAGTCAGG No data
1198087833_1198087839 -9 Left 1198087833 X:133297061-133297083 CCACCAGGCCCAGCCCCTGCCTC No data
Right 1198087839 X:133297075-133297097 CCCTGCCTCGCTTCTCAGTCAGG No data
1198087831_1198087839 18 Left 1198087831 X:133297034-133297056 CCAAAATGTTGGTATCACATGTG No data
Right 1198087839 X:133297075-133297097 CCCTGCCTCGCTTCTCAGTCAGG No data
1198087828_1198087839 28 Left 1198087828 X:133297024-133297046 CCTCGGCCTCCCAAAATGTTGGT 0: 6
1: 566
2: 15082
3: 163514
4: 298503
Right 1198087839 X:133297075-133297097 CCCTGCCTCGCTTCTCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198087839 Original CRISPR CCCTGCCTCGCTTCTCAGTC AGG Intergenic
No off target data available for this crispr