ID: 1198087881

View in Genome Browser
Species Human (GRCh38)
Location X:133297589-133297611
Sequence CTGTCAGAGGGGTGTGCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198087881_1198087891 7 Left 1198087881 X:133297589-133297611 CCCCAAGCACACCCCTCTGACAG No data
Right 1198087891 X:133297619-133297641 AAGGCAGCCCTTAAGTGACAGGG No data
1198087881_1198087890 6 Left 1198087881 X:133297589-133297611 CCCCAAGCACACCCCTCTGACAG No data
Right 1198087890 X:133297618-133297640 GAAGGCAGCCCTTAAGTGACAGG No data
1198087881_1198087894 21 Left 1198087881 X:133297589-133297611 CCCCAAGCACACCCCTCTGACAG No data
Right 1198087894 X:133297633-133297655 GTGACAGGGTAAGATCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198087881 Original CRISPR CTGTCAGAGGGGTGTGCTTG GGG (reversed) Intergenic