ID: 1198089043

View in Genome Browser
Species Human (GRCh38)
Location X:133309554-133309576
Sequence CATTGGGAATGGAATGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 281}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198089043 Original CRISPR CATTGGGAATGGAATGCAGA AGG (reversed) Intronic
901616467 1:10543841-10543863 CTTTGGGAAGGCAAGGCAGAAGG - Intronic
901736732 1:11317349-11317371 CTTTGGGAATCCAAGGCAGAAGG - Intergenic
902729196 1:18357449-18357471 CATGGGGATGGGAATGGAGATGG + Intronic
903910851 1:26723788-26723810 CATTGGAGGTGGAATGGAGAGGG - Intronic
904309772 1:29621236-29621258 CAGTGGGAATGGGAAGGAGAAGG + Intergenic
904372157 1:30056121-30056143 CAGTGGGAATGGAATGGACGTGG - Intergenic
905175292 1:36131389-36131411 CTTTGGGAAGGGAAGGTAGAAGG + Intergenic
906224027 1:44106239-44106261 AAGTGGGAGTGGAATGGAGATGG - Intergenic
907622890 1:55999961-55999983 CTTTGGCAATGGAATTCACATGG - Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907804762 1:57807125-57807147 CATGGAGAATGGACTGGAGAAGG - Intronic
909093643 1:71258966-71258988 CATTGCCAATGGCAAGCAGAAGG + Intergenic
909097923 1:71312935-71312957 AATTGAGAATGGACTGCAGTGGG - Intergenic
910018325 1:82554006-82554028 CATTGGCCTTGGATTGCAGAAGG + Intergenic
910488004 1:87737291-87737313 CATTGGGCATCCAATGCAAATGG + Intergenic
912015147 1:105025223-105025245 CATTGGGTAGGGTATTCAGAAGG + Intergenic
915586955 1:156849111-156849133 CACTGGGAATGGGATGCCGCGGG - Intronic
916044778 1:160991274-160991296 CAGGGAGAAAGGAATGCAGAAGG - Intergenic
916187682 1:162148757-162148779 CATGGAGAATGGTTTGCAGAGGG + Intronic
921760024 1:218902361-218902383 CATTGAGAGTAGAATGCAGAAGG - Intergenic
923206657 1:231765605-231765627 CATTTCTAATGGAATGCAGGTGG - Intronic
924574083 1:245263305-245263327 CACTCGGAAGGGAAGGCAGAGGG + Intronic
1063165062 10:3454243-3454265 CATTGGGGATGTTATGGAGAAGG - Intergenic
1063273797 10:4541470-4541492 GTTTTGGAAGGGAATGCAGAAGG - Intergenic
1064754189 10:18559839-18559861 AATGGGGAATGGAATGCAGTGGG + Intronic
1064754323 10:18560754-18560776 AATAGAGAATGGAATGGAGATGG + Intronic
1064755869 10:18571490-18571512 AATGGGGAATGGAATGGAAAGGG - Intronic
1064755901 10:18571683-18571705 AATGGAGAATGGAATGGAGATGG - Intronic
1064756066 10:18572711-18572733 GATGTGGAATGGAATGGAGAAGG - Intronic
1068550713 10:58404837-58404859 CCTTGGGAAAGAAAGGCAGAAGG - Intergenic
1068732130 10:60370954-60370976 TATTGAGAATGGAATGCACAGGG - Intronic
1069163864 10:65124676-65124698 AATTGGGAATATAATGGAGATGG + Intergenic
1069219345 10:65864185-65864207 AATTGGGAATGGAAACCAGATGG + Intergenic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1069688050 10:70331737-70331759 CGTTGGGAGTGGAATGGAGTGGG - Intronic
1069780606 10:70953101-70953123 GGTTGGGAGTGGAAGGCAGATGG - Intergenic
1069851710 10:71409576-71409598 ATTTGGGAGTGGAAAGCAGAGGG + Intronic
1071222869 10:83490269-83490291 CATGGGGAAAAGAGTGCAGAAGG - Intergenic
1072132219 10:92505824-92505846 CAGTTGGAGTGGAATGCAAATGG + Intronic
1072306480 10:94112651-94112673 CATTGGATATGGTATGCAGTGGG + Intronic
1072374871 10:94804126-94804148 CTTTGAGGATGGAATGGAGAGGG + Intronic
1073036560 10:100567793-100567815 CCTAGGGAAGGGAATGCTGAGGG - Intergenic
1073204534 10:101761951-101761973 CAGAGGGAATGGAAAGCAAAGGG - Intergenic
1073705027 10:105973440-105973462 GATTGTGAATGGAAAGCAGCTGG - Intergenic
1073803187 10:107066166-107066188 CATTTGGTCTGGAATGGAGAGGG + Intronic
1074756979 10:116631263-116631285 CATTTGGAAAGAAATCCAGATGG - Exonic
1074877138 10:117622262-117622284 CATTGGGAAGGTGTTGCAGAAGG - Intergenic
1075346063 10:121682689-121682711 CCTTAGGAATGGATGGCAGAGGG - Intergenic
1075568025 10:123518825-123518847 CATTGGGAATGCAAATCTGAAGG - Intergenic
1075681166 10:124333157-124333179 CATTCGGAAGAGAATGCAGAAGG + Intergenic
1075739511 10:124685768-124685790 CCATGGGAAAGGAAGGCAGATGG - Intronic
1076057465 10:127387216-127387238 CAGTGTGGCTGGAATGCAGAGGG - Intronic
1081131082 11:39381316-39381338 CATGAGGGATGGAATGCAGCAGG - Intergenic
1081227440 11:40541565-40541587 CATTGGGACTGTGATGGAGAAGG - Intronic
1081729341 11:45358156-45358178 CATTTGGGATGGAGGGCAGAGGG + Intergenic
1081759150 11:45564905-45564927 CATTGAGAATAGACTGCAGAGGG + Intergenic
1086398984 11:86445461-86445483 CAGTGAGAAGGAAATGCAGAAGG + Intronic
1087172138 11:95060026-95060048 CATTGGCCCTGGAATGCAGGAGG + Intergenic
1088109340 11:106244491-106244513 CATTGGGACTGGACAGAAGAAGG + Intergenic
1088336884 11:108715268-108715290 CTTTGGGAATCCAAGGCAGAAGG + Intronic
1090332235 11:125941382-125941404 CTCCGGGAATGGAAAGCAGATGG + Intergenic
1092005290 12:5064231-5064253 CATTGGGAAGAGAAAGAAGAAGG + Intergenic
1092277960 12:7076575-7076597 CATTGGGAAGAGAATGCAGGAGG - Intergenic
1092978176 12:13766426-13766448 CATTTGGATTGAAATGCACATGG - Intronic
1093777601 12:23095611-23095633 CATTGGAAATGGAATATAGAAGG - Intergenic
1093872066 12:24304886-24304908 TATTGGAAATGGAAGGCAGGAGG - Intergenic
1095813902 12:46400608-46400630 TATTTGGAATGGATTCCAGAAGG + Intergenic
1096476121 12:51910283-51910305 GAGTGGGAGTGGGATGCAGAGGG - Intronic
1098488234 12:71046451-71046473 AAATGGAAATGGAATTCAGATGG - Intergenic
1098789908 12:74808399-74808421 CTTTGGGAATCCAATGCAGGAGG - Intergenic
1099373748 12:81870818-81870840 GATTAAGAATGGAATTCAGAAGG + Intergenic
1100803634 12:98258902-98258924 GACTGAGAATGGAATCCAGACGG + Intergenic
1101726770 12:107394489-107394511 AAATGGGAAATGAATGCAGATGG + Intronic
1102366506 12:112340915-112340937 CATTGAGGTTTGAATGCAGAAGG - Intronic
1103185596 12:118954518-118954540 CAATGGGAAAGGATTGCACAAGG + Intergenic
1104034853 12:125091217-125091239 CATGGAGAATGGATTGCAGGGGG + Intronic
1104060615 12:125264784-125264806 CAAGGGGAAAAGAATGCAGATGG - Intronic
1104372025 12:128231902-128231924 GAATGGGGATGGAATGCAGGAGG - Intergenic
1104375027 12:128258247-128258269 CACTGCTACTGGAATGCAGAGGG - Intergenic
1108021005 13:46127596-46127618 CATGGGGAAAGGAATGAAGAGGG - Exonic
1108539469 13:51425468-51425490 CATTGGTAAAGAGATGCAGAAGG + Intronic
1109533139 13:63679646-63679668 CATTTGTAATGGAATGCATCTGG + Intergenic
1110711391 13:78654900-78654922 AATTGGGATTGGAATGTAGGTGG - Intronic
1111489761 13:88956514-88956536 CATTGGAAATGGAAAGAAGATGG + Intergenic
1112047707 13:95614577-95614599 CATGGAGAAAGGAATGGAGAGGG + Intronic
1112261705 13:97883628-97883650 CATTGGCAATACAATACAGAAGG + Intergenic
1112841271 13:103581397-103581419 CATGGGGAATGAAATGGAGAAGG + Intergenic
1114040818 14:18676792-18676814 AATTGAGCATGGAATGCAGACGG + Intergenic
1114045856 14:18875296-18875318 AATTGAGCATGGAATGCAGACGG + Intergenic
1114118358 14:19644174-19644196 AATTGAGCATGGAATGCAGACGG - Intergenic
1114209568 14:20603516-20603538 GATGGGGCATGGTATGCAGATGG + Intronic
1114972810 14:28055502-28055524 CATTGGGGAGGAAATTCAGAAGG - Intergenic
1115434489 14:33357684-33357706 AATTGGGACCAGAATGCAGAAGG - Intronic
1115807328 14:37065579-37065601 TGTTGGGAATGGAATGGAGTAGG - Intronic
1116988452 14:51246533-51246555 CATTGGGAATGGGAAGGAGGAGG + Intronic
1118592288 14:67410732-67410754 CTTTGGGAGGGGAATGAAGAGGG - Intronic
1120157329 14:81107953-81107975 AATTAGGAATGGAATGAAGATGG - Intronic
1121144139 14:91568847-91568869 GGTTGGGAATGGCCTGCAGAGGG - Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1124994613 15:34710829-34710851 CTTTGGGAATCCAATGGAGAAGG + Intergenic
1125148746 15:36506086-36506108 CATTGGGTGTGAAATACAGAGGG - Intergenic
1125852293 15:42915644-42915666 CAATGGAAATAAAATGCAGAGGG + Intronic
1125918669 15:43511279-43511301 CATTGGTAGTTGAATGCAGAAGG - Intronic
1126656397 15:50982146-50982168 CATGGTGAAAGGAAAGCAGAAGG - Intronic
1126750021 15:51867096-51867118 CAGTGTGACTGGAATGGAGAGGG + Intronic
1130689080 15:86064682-86064704 ACTTGGGAATGGAATTCATAAGG - Intergenic
1130823246 15:87517398-87517420 CATTGGGCACGCAGTGCAGAGGG - Intergenic
1133056672 16:3148869-3148891 CCCTGGGATTGGAAGGCAGAGGG + Intronic
1135833788 16:25804526-25804548 CCTTGAGAGTGGAAAGCAGATGG + Intronic
1137484853 16:48882386-48882408 CCTTGGGAATGGATTCCATAGGG - Intergenic
1137664717 16:50243245-50243267 CATGGGAAATTGAATGCACACGG - Intergenic
1138761296 16:59547780-59547802 CGTTGGGATTGGTTTGCAGATGG + Intergenic
1139062376 16:63268433-63268455 CTTTGAAAATGGTATGCAGAGGG - Intergenic
1139286960 16:65824008-65824030 GATTGGGAGTGGAATGAAGGAGG - Intergenic
1140529891 16:75656096-75656118 CAGTGTGATTGGAATGCAGAGGG + Intronic
1141053923 16:80798441-80798463 CAATGGGAATGCCATGAAGATGG + Intronic
1141769101 16:86078124-86078146 CTCTGGGAAGGGAAGGCAGAGGG - Intergenic
1142212770 16:88816321-88816343 GATTGGGTGTGGAAGGCAGAAGG + Intronic
1142871892 17:2826555-2826577 CTTTGGGGATGGATTGCGGAAGG + Intronic
1144010393 17:11142860-11142882 GAATGAGAATGGAATGCAGCAGG + Intergenic
1144609654 17:16699027-16699049 CTTTAGGAATGGAATTCAAAAGG - Intronic
1144903116 17:18616524-18616546 CTTTAGGAATGGAATTCAAAAGG + Intergenic
1144927949 17:18829456-18829478 CTTTAGGAATGGAATTCAAAAGG - Intergenic
1145129454 17:20330226-20330248 CTTTAGGAATGGAATTCAAAAGG - Intergenic
1145223540 17:21108510-21108532 CAATGCCAATGGAATACAGAAGG - Intergenic
1146915631 17:36676648-36676670 CATGGGCTAAGGAATGCAGATGG + Intergenic
1147262064 17:39214503-39214525 CACTGGGACGGGAATGGAGAGGG + Intronic
1147632401 17:41940476-41940498 AACTGGGAATGGAAAGCATATGG - Intronic
1148012893 17:44499164-44499186 CATTAGAAATAAAATGCAGAGGG + Intronic
1148346914 17:46909272-46909294 CTTTGGGAAGCGAATGCAGGAGG - Intergenic
1148825977 17:50394726-50394748 CAGTGGGAAAGGAATTGAGATGG - Intronic
1148870604 17:50656924-50656946 TATTGGGAATGGGAAGAAGAAGG + Intronic
1149333716 17:55612440-55612462 CATTGTGAATGGAATCAAAAAGG - Intergenic
1149587797 17:57804452-57804474 CTTTGGGAAGGTAAGGCAGAAGG - Intergenic
1151174056 17:72272566-72272588 AATTAGGAAGGGAATCCAGAAGG - Intergenic
1156073070 18:33237171-33237193 CACTGGGCTTGGAATGAAGATGG - Intronic
1156137656 18:34062551-34062573 AATGGGGAATGGAATGGAAATGG - Intronic
1156650143 18:39216120-39216142 AATTGGGAAGGGAAAGCAGGTGG - Intergenic
1156704582 18:39864169-39864191 CATTGGAATTTAAATGCAGATGG + Intergenic
1158511621 18:58095497-58095519 AGATGGGACTGGAATGCAGAGGG + Intronic
1158724395 18:59956311-59956333 CACTGGGAATTGGATGTAGATGG + Intergenic
1159882417 18:73871108-73871130 CAATAGGAAAGGAATGAAGAAGG + Intergenic
1162500404 19:11050292-11050314 GAGTGGGAATGGAACCCAGAGGG - Intronic
1162794193 19:13078248-13078270 CATTGGGAAAGGAGTGCAGGAGG - Intronic
1163112199 19:15168283-15168305 CTTTGGGATGGGAAGGCAGAAGG + Intronic
1165291472 19:34889579-34889601 CCGAGGGACTGGAATGCAGAGGG - Intergenic
1165436132 19:35796608-35796630 CATTGGGAATGAAATGCAGTGGG - Intergenic
1166654721 19:44602401-44602423 CTTTGGCAGTGAAATGCAGAAGG - Intergenic
1168018827 19:53594464-53594486 CATTGGGACTGGAATGGAGGTGG + Intergenic
1168485505 19:56758954-56758976 CAATGGGAGTGGAAGGCTGAGGG + Intergenic
926105800 2:10150015-10150037 CATTGGAAATGGAGTGTAGCTGG + Intronic
926171146 2:10553222-10553244 CCTTGGGAATGGAAGGAACAGGG + Intergenic
926609142 2:14928238-14928260 CATTTGGAATCAAAGGCAGAGGG - Intergenic
926882528 2:17562848-17562870 GATTTGGAATGGAAGACAGATGG - Intronic
927742694 2:25586592-25586614 CACTGGGGATGGAAAGCTGAAGG + Intronic
928453910 2:31402438-31402460 CATTGGGAATGCTGTGCACAGGG + Intronic
929372262 2:41240616-41240638 CTTTGGGAAGGCAAAGCAGATGG - Intergenic
930151508 2:48064850-48064872 CATTGGCAATGGAAAGAAAATGG - Intergenic
932548249 2:72738271-72738293 TATGGGGAATGAAATGGAGAGGG - Intronic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
934987795 2:98900150-98900172 CAGTGGGAAGGGGAGGCAGATGG + Intronic
935283031 2:101535740-101535762 CAGGGGGAATGCAATTCAGAAGG - Intergenic
937574702 2:123406065-123406087 TATTTGGAATGGAAAGAAGAAGG - Intergenic
938269378 2:129955795-129955817 AATTGAGCATGGAATGCAGACGG - Intergenic
940920016 2:159295943-159295965 CAATTGGCATGGAATTCAGATGG - Intergenic
941394444 2:164956743-164956765 CCTGGGGAAAGGAATGGAGAAGG - Intergenic
942409849 2:175697518-175697540 CATAGGGAATGGAAGTCACAGGG + Intergenic
943743617 2:191438064-191438086 CAATGGGAATGGAATGGGGGTGG - Intergenic
943882779 2:193168636-193168658 CATTGACAATGGTATGAAGAGGG + Intergenic
944431324 2:199636773-199636795 CATTGGTAATGGAATACCCAAGG + Intergenic
945221727 2:207490457-207490479 CATTGTGAAGGGAGTGGAGAGGG + Intergenic
945437397 2:209835132-209835154 CATTGGGAATGAAATGTAAAGGG - Intronic
945464995 2:210158669-210158691 ACTTGGGAATAGAATACAGAAGG - Intronic
946489394 2:220133098-220133120 CAGTAGCAATGGAATGGAGAAGG - Intergenic
946516736 2:220420032-220420054 CATGGGGAAGGGAGAGCAGAGGG + Intergenic
947331944 2:229038007-229038029 CATTAGGAATGGATCACAGAAGG + Intronic
948315682 2:237026812-237026834 CATTGGGAATGGAGACCAGGTGG + Intergenic
1173507432 20:43599030-43599052 CGCTGGGAATGGCATGGAGAGGG + Intronic
1175481164 20:59312203-59312225 CATTCGGCCTGGAATTCAGAAGG + Intronic
1178753893 21:35329281-35329303 CATTGGAAATGGCAAGAAGATGG - Intronic
1180464387 22:15597913-15597935 AATTGAGCATGGAATGCAGACGG + Intergenic
1181782995 22:25206616-25206638 GATTGGGACTGGGATGCACAAGG + Intronic
1185043079 22:48515669-48515691 CATTGGGCATTGGATGCAGCAGG - Intronic
953537206 3:43785549-43785571 CTTTGGGAATAGAATCAAGAAGG - Intergenic
954569098 3:51625613-51625635 CATTGGGAATGTGAGGCAGAAGG + Intronic
954710002 3:52500955-52500977 CAGTGGGAATGCAGTGCAGATGG - Intronic
954935391 3:54322098-54322120 CATTGGGAGTGGAAGGAGGAGGG + Intronic
955265153 3:57435823-57435845 CCTTGGGTATTGAATGCATAAGG + Intronic
955953655 3:64266965-64266987 GGTTGAGAATCGAATGCAGAGGG - Intronic
959197225 3:103199919-103199941 CATTGGGAAGGGAATGAACTTGG + Intergenic
959836642 3:110925578-110925600 CATTGGGTCTTGAATGGAGAAGG - Intergenic
960465451 3:117992374-117992396 CTTTGGGAAACAAATGCAGAAGG - Intergenic
961202270 3:125054965-125054987 CATTGGGAAAGGAAAGGGGAGGG + Intronic
961818457 3:129563273-129563295 CATGGGGGCTGGAATACAGAGGG - Intronic
962350048 3:134650070-134650092 CAATGTGAATGGAGTACAGAGGG - Intronic
963478989 3:145844956-145844978 CATTGGGAAAATATTGCAGATGG - Intergenic
965557073 3:170029472-170029494 CATTGTGAATGGGTTGAAGAAGG + Intergenic
966730810 3:183150012-183150034 GATGGGGAATGGAATGAATAAGG + Intronic
967553913 3:190832029-190832051 CAGTGGCAATGGAGTCCAGATGG + Intergenic
971030343 4:22630121-22630143 TTTTGTGAATGGAATGAAGATGG - Intergenic
972301851 4:37792234-37792256 CATGGTGAATGCAGTGCAGAAGG + Intergenic
973096362 4:46205793-46205815 TATTCAGAATGCAATGCAGAGGG + Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974473046 4:62342992-62343014 TATTGTGAATAGAATGCAGTTGG + Intergenic
974551990 4:63387893-63387915 CATTGGAAACCAAATGCAGATGG - Intergenic
974676003 4:65090225-65090247 ACTTGGGCATGGAATGGAGAGGG + Intergenic
975990084 4:80250117-80250139 CTTTGGGAAGCCAATGCAGATGG - Intergenic
976141361 4:81996033-81996055 AGTTTGGAATGGAATGTAGAGGG + Intronic
982087288 4:151848618-151848640 CAATAGAAATGGAAAGCAGATGG + Intergenic
982104123 4:151997100-151997122 CATTGGGAATGGAAAGAGGAAGG + Intergenic
982544927 4:156722450-156722472 GATTGGAAGTGGAATGCAGCAGG + Intergenic
983000086 4:162403518-162403540 CAATGGAAATGGAAGGCTGAAGG - Intergenic
983553929 4:169043272-169043294 TATGGAGAATGGAGTGCAGAGGG - Intergenic
983843322 4:172483346-172483368 CATTGTGAAGGGAGTGCAGAGGG + Intronic
986565673 5:9111299-9111321 AAATGGGTATGGAAGGCAGAGGG + Intronic
987628836 5:20440987-20441009 CATTTTGCATGGAATGAAGAAGG + Intronic
988527486 5:31999701-31999723 CATTAGGTAAGGAATGCAGGTGG + Intronic
988872278 5:35404316-35404338 AATTAGGGATGGATTGCAGAAGG + Intergenic
991293809 5:65060248-65060270 TATGGGGAATGGATTGCAGGAGG + Intergenic
991979395 5:72215715-72215737 CATTGGGAATGCACTGGGGAAGG + Intergenic
992030107 5:72712612-72712634 AATTTGGAATGGAATATAGATGG + Intergenic
994116719 5:96069742-96069764 CATTGGGAAGTGAAGGCAGGAGG - Intergenic
995441775 5:112200162-112200184 CATTGGGAATGGAAAGAAGCAGG - Intronic
995565617 5:113430922-113430944 CATGGAGAATGGAAAGGAGAGGG + Intronic
996119084 5:119650971-119650993 CAGTGTGAATGGAAGTCAGATGG + Intergenic
996141428 5:119913814-119913836 CCTTGGGAGTGGAAGGCAGGAGG - Intergenic
996201118 5:120675210-120675232 CATTGGGAAAGTCATGAAGATGG - Intronic
996381101 5:122863374-122863396 CAGTGGGTTTGGAATGCAGTAGG + Intronic
997642927 5:135461538-135461560 CATTCGGAATCGAATGTTGAGGG + Intergenic
997799309 5:136843858-136843880 CATTGGGAATGGAGTTCAAGAGG + Intergenic
998546369 5:143031311-143031333 CATAGGGGCTGCAATGCAGAGGG + Intronic
1002329554 5:178432277-178432299 CAGAGGGAATTTAATGCAGACGG + Intronic
1002771305 6:292539-292561 CATGGGGAATGGGATGAACAAGG + Exonic
1003020555 6:2505330-2505352 CATTTGGAATGGGCAGCAGAGGG - Intergenic
1007931698 6:45697788-45697810 CTTTTGGAATGCATTGCAGAAGG - Intergenic
1011073637 6:83413863-83413885 CATTGGGAGGGTAAAGCAGAAGG + Intronic
1012417543 6:99026084-99026106 CATTGTGAATAGAATCCTGAGGG - Intergenic
1012473105 6:99592030-99592052 CATTGGGAATTGAAATGAGAGGG - Intergenic
1013420544 6:109962735-109962757 CATTGAGAATGGAAGGAAGGTGG + Intergenic
1013525364 6:110969066-110969088 CAGTGGAAATGGAAGACAGAAGG - Intergenic
1013766199 6:113577261-113577283 CTTTGGGAAGCCAATGCAGAAGG + Intergenic
1016221496 6:141676803-141676825 CATTGGGAATGGAACCTAGTTGG + Intergenic
1016873658 6:148843135-148843157 CAGGGGGAATGGGAAGCAGATGG + Intronic
1016911825 6:149207069-149207091 CCTTGGGAATCTAATGCAGATGG - Intergenic
1017691520 6:156970703-156970725 GATTGGGACAGCAATGCAGAAGG - Intronic
1017971548 6:159316043-159316065 CATTGGGAACGCAATAAAGAAGG - Intergenic
1018158608 6:161014671-161014693 CATTGGAATTGGAATTCACATGG + Intronic
1018906541 6:168079197-168079219 CACTGGGAAGGGAATTGAGAGGG + Intronic
1019686737 7:2386046-2386068 CAGGGGGAGTGGACTGCAGAGGG + Intergenic
1019923464 7:4177521-4177543 CATTGAAAATAGAATGTAGAAGG - Intronic
1020393125 7:7682306-7682328 CATTGAGACTGGAAAACAGAAGG - Intronic
1020898847 7:13976827-13976849 CTTAGGGAAAGGAACGCAGAAGG + Intronic
1021257364 7:18409511-18409533 GGTTGGGAAGGGAATGCAGAGGG - Intronic
1023179589 7:37468770-37468792 CAGAGTGAATGGATTGCAGAGGG - Intergenic
1023786645 7:43714762-43714784 CTTTGGGAAACCAATGCAGATGG + Intronic
1024196611 7:47065251-47065273 CTCTGGCCATGGAATGCAGATGG - Intergenic
1025145035 7:56494858-56494880 CCTTGGGAAGGGTCTGCAGAGGG - Intergenic
1026028366 7:66766681-66766703 CAGTGGGAATGGAAAGACGACGG - Intronic
1026910818 7:74090790-74090812 CACTGGGAGGGGCATGCAGAGGG - Intronic
1028480035 7:91294188-91294210 GATTTGGAATGGTTTGCAGAAGG - Intergenic
1029605887 7:101599168-101599190 CAGAGGGAATGGAACTCAGATGG + Intergenic
1030275935 7:107721809-107721831 CTTTGGGGTAGGAATGCAGATGG - Intergenic
1034576426 7:152002772-152002794 CCTTGGCAATGGCATGCAGCAGG - Exonic
1035947103 8:3977303-3977325 CATTGGGAAAGGAATGAAATGGG - Intronic
1036183330 8:6603309-6603331 GAATGGCAATGGAATGCATAGGG + Intronic
1040611005 8:48982237-48982259 AATTGGGTATCAAATGCAGAAGG - Intergenic
1042873183 8:73416512-73416534 CAATGGGAATGAAATCAAGAGGG + Intergenic
1043816052 8:84802884-84802906 GGCTGGGAATGGAATGCAGAGGG + Intronic
1044785837 8:95791690-95791712 CATTGGGAGTGGGATGGACAGGG + Intergenic
1044822170 8:96161723-96161745 AAGAGGGATTGGAATGCAGAAGG - Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045340187 8:101246749-101246771 CATGGGCCAGGGAATGCAGATGG + Intergenic
1046268968 8:111867979-111868001 CTTTGGGAATGTAATACAAATGG - Intergenic
1046760638 8:118016450-118016472 CCTTGGGAAATGAATGCAGTAGG + Intronic
1048266044 8:132987975-132987997 CAGTGGGGATGGTGTGCAGATGG - Intronic
1048319472 8:133387166-133387188 CTTTGGCAGTGAAATGCAGAAGG + Intergenic
1049463559 8:142740974-142740996 CGTGGGGTATGGAAGGCAGAGGG + Exonic
1051989639 9:23136811-23136833 CATTGAGAATGGATTATAGAAGG - Intergenic
1052174468 9:25441663-25441685 CATTAAGAATGGAATGAAGGGGG + Intergenic
1052357131 9:27516730-27516752 TATGGGGAATGGAATGAAGTGGG - Intronic
1052418489 9:28208888-28208910 GATGGGAAATGGAAAGCAGATGG - Intronic
1054869000 9:70031891-70031913 CACTGGAAATGGAATAAAGAGGG - Intergenic
1055002128 9:71463518-71463540 TACTGGGAAAGGAATGCATAAGG - Intergenic
1055370311 9:75591409-75591431 CATCGGCAGTGGAATGCAGGAGG - Intergenic
1056126662 9:83541302-83541324 CATTGGGAAGTGAATTCAAATGG - Intergenic
1058561019 9:106229231-106229253 CCTTGGAAGTAGAATGCAGAAGG + Intergenic
1059093264 9:111384482-111384504 CATTGGGAATGGAGTGGAGCAGG - Intronic
1059511292 9:114850559-114850581 CTTTGGGAAAGGAATGGAGTAGG + Intergenic
1060038509 9:120279990-120280012 CACTGGGAATGGAATAAACAAGG - Intergenic
1185591903 X:1282863-1282885 CATTAGAGATGAAATGCAGATGG - Intronic
1185923533 X:4120982-4121004 CTTTGGGAGGGCAATGCAGAAGG - Intergenic
1186041916 X:5488781-5488803 GATTGGGAATAGCATGAAGAAGG + Intergenic
1187501393 X:19842070-19842092 GAATGGGGATGGACTGCAGATGG + Intronic
1187674433 X:21701690-21701712 CATAGGGTAGGGAATTCAGAAGG - Intergenic
1187956459 X:24523535-24523557 GAATGGGAAGGGAAGGCAGAGGG + Intronic
1189066555 X:37815942-37815964 CACTGGGTAAGGAATGCAGCAGG - Intronic
1190640736 X:52481427-52481449 CATTGGGTAGGGACTGCAGAGGG + Intergenic
1190646936 X:52531438-52531460 CATTGGGTAGGGACTGCAGAGGG - Intergenic
1190930784 X:54948252-54948274 CATCGGAGATGGAATGAAGAAGG - Intronic
1192219021 X:69184443-69184465 CACTGGGAGTGGAGTGGAGAAGG - Intergenic
1192315803 X:70050374-70050396 CAATGGGATTGGAGGGCAGAGGG + Intergenic
1192369606 X:70502328-70502350 CATGGGGACAGGAATGAAGAGGG - Exonic
1192504092 X:71670426-71670448 CATGGGGTATGGTAGGCAGAGGG - Intergenic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196322331 X:114355798-114355820 CATGGGGAATGAAATGTAGGGGG + Intergenic
1197188248 X:123613154-123613176 AGGTGGGAATGGAATGGAGAGGG + Intronic
1197394025 X:125903675-125903697 TATTGGTAATGGACTGGAGAGGG + Intergenic
1197680539 X:129378807-129378829 AATTGGGGATGGAGAGCAGAGGG + Intergenic
1197948269 X:131863970-131863992 CATGTGGAAAGGAATGAAGATGG - Intergenic
1198089043 X:133309554-133309576 CATTGGGAATGGAATGCAGAAGG - Intronic
1198147628 X:133873288-133873310 CATTGGCAAAAGAATGCCGAAGG - Intronic
1198878969 X:141258025-141258047 AATTTGGAATGGAATTCAGCAGG + Intergenic
1199850132 X:151720275-151720297 CATTGTGGATGGGAAGCAGATGG - Intronic
1199974103 X:152882282-152882304 TAATGGGAATGGAATGGAGGAGG + Intergenic
1201101835 Y:10683954-10683976 CGCTTGGACTGGAATGCAGAGGG + Intergenic
1201361133 Y:13150366-13150388 AAAAGGGAGTGGAATGCAGAGGG - Intergenic
1201481319 Y:14442404-14442426 CATTGGCAATGAAATGGACAAGG - Intergenic