ID: 1198090280

View in Genome Browser
Species Human (GRCh38)
Location X:133322103-133322125
Sequence GTGGACTGGCCAGGATACAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198090280_1198090288 25 Left 1198090280 X:133322103-133322125 CCCGTGTATCCTGGCCAGTCCAC No data
Right 1198090288 X:133322151-133322173 TTAGTGACACCTGGCCAGCACGG No data
1198090280_1198090289 28 Left 1198090280 X:133322103-133322125 CCCGTGTATCCTGGCCAGTCCAC No data
Right 1198090289 X:133322154-133322176 GTGACACCTGGCCAGCACGGTGG No data
1198090280_1198090287 16 Left 1198090280 X:133322103-133322125 CCCGTGTATCCTGGCCAGTCCAC No data
Right 1198090287 X:133322142-133322164 TACTAACAATTAGTGACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198090280 Original CRISPR GTGGACTGGCCAGGATACAC GGG (reversed) Intronic