ID: 1198090280

View in Genome Browser
Species Human (GRCh38)
Location X:133322103-133322125
Sequence GTGGACTGGCCAGGATACAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198090280_1198090288 25 Left 1198090280 X:133322103-133322125 CCCGTGTATCCTGGCCAGTCCAC 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1198090288 X:133322151-133322173 TTAGTGACACCTGGCCAGCACGG 0: 1
1: 0
2: 1
3: 12
4: 130
1198090280_1198090289 28 Left 1198090280 X:133322103-133322125 CCCGTGTATCCTGGCCAGTCCAC 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1198090289 X:133322154-133322176 GTGACACCTGGCCAGCACGGTGG 0: 1
1: 0
2: 0
3: 9
4: 144
1198090280_1198090287 16 Left 1198090280 X:133322103-133322125 CCCGTGTATCCTGGCCAGTCCAC 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1198090287 X:133322142-133322164 TACTAACAATTAGTGACACCTGG 0: 1
1: 0
2: 0
3: 11
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198090280 Original CRISPR GTGGACTGGCCAGGATACAC GGG (reversed) Intronic
900366402 1:2313600-2313622 TGGCACTGGCCAGGGTACACGGG - Intergenic
913348825 1:117835192-117835214 GTGGATTGGCAAGGATAAATGGG + Intergenic
920175452 1:204098701-204098723 GAGGACTGGCCAGAACACAGAGG + Intronic
920415122 1:205794402-205794424 ATGGAATGGCAAGGCTACACAGG + Intronic
922794898 1:228335135-228335157 GTGGATTGGCCCTGACACACCGG + Exonic
924946789 1:248851873-248851895 GTGGACTGGCCTGGAATCATGGG - Intronic
1062985644 10:1766112-1766134 GAGGACTGGCCAGAATGCAAAGG - Intergenic
1065937632 10:30534889-30534911 GTGGTCAGGCCATGATACAGAGG - Intergenic
1067165594 10:43864243-43864265 GTGGACAGGCAAGGGCACACTGG - Intergenic
1072547985 10:96455337-96455359 GCTGATTGGCCAAGATACACTGG + Intronic
1072743521 10:97924335-97924357 CTGGGCTGGACAGGAAACACAGG + Intronic
1072747399 10:97950548-97950570 TTGGACAGGCAAGGAGACACAGG + Intronic
1072847281 10:98845754-98845776 GTGCACTGGTCAGGACACACTGG - Intronic
1073942024 10:108710471-108710493 GTGGACTGTGCAGGAAACACAGG - Intergenic
1074216591 10:111390778-111390800 GTGTACTGGCCATGTTACATTGG + Intergenic
1076682353 10:132179657-132179679 GGGGACTCGCTAGGATTCACAGG + Intronic
1079073752 11:17370379-17370401 GTGCATTGGCCAGGAAACATTGG + Intronic
1079131052 11:17747228-17747250 GTGACCTGCCCAGGACACACAGG - Intronic
1080845179 11:36020742-36020764 GTGGGCTGGCCAGGATACCCAGG + Intronic
1083898678 11:65633231-65633253 CTGGCATGGCCAGGATGCACGGG - Intronic
1084111351 11:67015920-67015942 GAGGCCTGGCCAGGTCACACTGG + Intronic
1090081795 11:123618499-123618521 CTGGATGGGCCAGGATACAGGGG - Intronic
1092858033 12:12693554-12693576 GTATAATTGCCAGGATACACAGG - Intronic
1097119818 12:56722718-56722740 TTGGAGTGGCGAGAATACACTGG + Intronic
1102451293 12:113043850-113043872 GTGCACTGGCAAGGAGGCACAGG - Intergenic
1104243757 12:127017125-127017147 GTAGACTGGCCAAGAACCACAGG - Intergenic
1108669002 13:52662828-52662850 GTGGACTTCCAAAGATACACTGG + Intronic
1111577035 13:90168478-90168500 TAGGACTGGCTAGGATACACTGG - Intergenic
1112146749 13:96708680-96708702 GTGGCCTGGCCAGGATCCTTGGG - Intronic
1113539479 13:111095165-111095187 GTGGACTGGCCAGCACCCCCTGG - Intergenic
1123038913 14:105482541-105482563 GGGACCTGGCCAGGAGACACGGG - Intergenic
1125997428 15:44177000-44177022 GAGGATTGGCCAGGAGAAACTGG + Intronic
1129606254 15:77026486-77026508 GTGGTATGGCCAGGACACCCAGG - Intronic
1132299556 15:100767555-100767577 GCGGACTGGCCAGCCGACACGGG - Intergenic
1132973454 16:2700227-2700249 GTGGGCTGGCCAGGAGGCTCTGG - Intronic
1136911607 16:34148605-34148627 GGTGACTGCCCAGGATACAGTGG - Intergenic
1140301162 16:73758628-73758650 GTGGCCTGGTCTGAATACACAGG + Intergenic
1141642368 16:85348740-85348762 GTGGATTGTCCAGGAGACTCGGG + Intergenic
1141702291 16:85648088-85648110 GTGGACATCCCAGGACACACAGG - Intronic
1145056494 17:19706969-19706991 GTGGACTGGCCAGGTGAGCCTGG - Intronic
1146663460 17:34681014-34681036 TTGTACTGGCGAGGATACAGTGG + Intergenic
1147541106 17:41360722-41360744 GTGGTCTGGCCAGTCTACAGAGG - Intergenic
1157447510 18:47756327-47756349 GTGGGCTGGCCAGAAAACAGAGG - Intergenic
1160681424 19:413226-413248 GTGGAGGGGCCAGGATGCCCCGG - Intergenic
1160681449 19:413300-413322 GTGGAGGGGCCAGGATGCCCCGG - Intergenic
1160681474 19:413374-413396 GTGGAGGGGCCAGGATGCCCCGG - Intergenic
1160975626 19:1790906-1790928 TTGGTCGGGCCAGGATTCACCGG - Intronic
1163821632 19:19499533-19499555 GCGCACTGCCCAGGATACAGAGG + Intronic
1168684805 19:58342135-58342157 GTAGACTGGGCAGCACACACAGG - Exonic
926400499 2:12491605-12491627 CTGGCCTGGCCAGGATAGAGAGG + Intergenic
927464679 2:23328339-23328361 GTGAACTGGTGTGGATACACTGG + Intergenic
929653233 2:43703172-43703194 GTTGACTGTCCAGGACACAGTGG - Intronic
933589248 2:84213917-84213939 GCAGACTGGCCAGGACAAACAGG - Intergenic
936236704 2:110748335-110748357 GTGGAGTGCCCAGGATGCAGGGG + Intronic
939573570 2:143869090-143869112 GCAGACTGGCCAAGAAACACAGG + Intergenic
941989821 2:171544739-171544761 CTGCACTGGCTAGGATACAGAGG - Intronic
943742654 2:191427108-191427130 GAGGCCAGGCCAGAATACACAGG - Intergenic
944949201 2:204727872-204727894 GTGGTCTGGCCAGTCTACAGAGG - Intronic
948027387 2:234789104-234789126 GTTGGCTGGTCAGGATTCACTGG - Intergenic
1170066158 20:12312773-12312795 GTTGCCTGGCCAGGAGAAACAGG + Intergenic
1171906930 20:30906888-30906910 GGTGACTGCCCAGGATACAGTGG - Intergenic
1172730348 20:37081994-37082016 GTCAACTGGCCAGGAGACATAGG + Intronic
1175353742 20:58345758-58345780 ATGCACTGCCCAGGATAAACGGG - Intronic
1176090973 20:63318504-63318526 GGGCACTGGCCAGGACCCACTGG + Intronic
1176551605 21:8225116-8225138 GGTGACTGCCCAGGATACAGTGG - Intergenic
1176570514 21:8408115-8408137 GGTGACTGCCCAGGATACAGTGG - Intergenic
1176578423 21:8452290-8452312 GGTGACTGCCCAGGATACAGTGG - Intergenic
1179035141 21:37753028-37753050 GTGGGCTGGGCAGGGAACACAGG + Intronic
1179502023 21:41815963-41815985 GTGGACTGACCGGGATCCTCGGG - Intronic
1180632902 22:17241977-17241999 GTGGAGTGGCCAGGATCCAGGGG + Intergenic
1183456006 22:37923772-37923794 GTGGATGGGCCAGGACACACAGG - Intronic
1185012090 22:48319882-48319904 GTGGCCAGGCCAGGATGCTCTGG + Intergenic
1203256627 22_KI270733v1_random:142038-142060 GGTGACTGCCCAGGATACAGTGG - Intergenic
953910792 3:46892031-46892053 TTGGACTTGCCAGGATCCAGGGG - Intronic
953980572 3:47411012-47411034 GTGGACTGGCCAGCAGACGAGGG - Exonic
964549019 3:157866083-157866105 GGTGACTGGACATGATACACTGG - Intergenic
966856339 3:184196473-184196495 GTGGTCTGGCCAGGAGAAACAGG - Intronic
969188424 4:5497449-5497471 GTGGACTGGGCAGGAACCAGAGG - Intronic
981435203 4:144711838-144711860 GTGGACTGGCAAGGATCCTATGG - Intronic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
998205101 5:140152318-140152340 GTGGGCTGGCCAGAAATCACAGG + Intergenic
1006171628 6:32096573-32096595 GTGTGCTGGCCGGGGTACACTGG - Intronic
1006171666 6:32096759-32096781 GTGTGCTGGCCCGGGTACACAGG - Intronic
1006525229 6:34598899-34598921 AGGGACTTGCCAGGATACTCTGG - Intronic
1006837334 6:37006943-37006965 GTGGACTGGACAAGAGACTCTGG + Intronic
1006922418 6:37635525-37635547 GTGGCCGGGCCAGGATGCAGCGG - Exonic
1007275814 6:40672807-40672829 GTGGGCAGGCCAGGAAAGACAGG + Intergenic
1007401657 6:41606028-41606050 GTGGACTGGGCAGGACACCTGGG + Intergenic
1011938119 6:92807391-92807413 GTTGAATGGCCAGGAAAGACTGG - Intergenic
1013603467 6:111726595-111726617 ATGGACTGGCCAGGATTCCATGG - Intronic
1014048014 6:116916043-116916065 TTGCATTGTCCAGGATACACTGG - Exonic
1015127626 6:129771900-129771922 GTGGTCTGGCCAGTCTACAGAGG + Intergenic
1017224023 6:151999043-151999065 GAGGACTGGCCAGGAGAACCAGG - Intronic
1017648033 6:156556846-156556868 CTGGGCTGGGCTGGATACACAGG - Intergenic
1018862177 6:167719194-167719216 GTGGACAGGCCAGCATGCTCAGG - Intergenic
1024348078 7:48333843-48333865 GTGACCTGGCCTGGAAACACTGG - Intronic
1034478448 7:151302318-151302340 ATGGACTGGCTCGGAAACACAGG + Intergenic
1035224044 7:157424007-157424029 GTGGCCTCGTCAGGACACACAGG - Intergenic
1036772340 8:11587894-11587916 GTGGCCTGGCTGGGAGACACTGG - Intergenic
1037678147 8:21069974-21069996 GTGGACTAGCCAGCTAACACTGG + Intergenic
1038865701 8:31436765-31436787 GAGGTCTGGCCAGGAGACCCTGG - Intergenic
1040594057 8:48820820-48820842 GGTGACTGGCCAGGAGCCACAGG - Intergenic
1041781708 8:61584503-61584525 GTGGTCAGTCCAGGATGCACTGG - Intronic
1045146447 8:99349872-99349894 GTGGAGTGGCAAAGATACAGTGG + Intronic
1052351762 9:27465660-27465682 GTGGACATGCCTGGATACCCAGG - Intronic
1053152282 9:35750668-35750690 GTGGAGTAGAAAGGATACACTGG - Exonic
1056657637 9:88522394-88522416 ATGGGCTGGCCAGGATAAAGGGG - Intergenic
1057230738 9:93319938-93319960 GTGGACCGGGCAGGAGACACTGG - Intronic
1060526787 9:124325393-124325415 GGGAACTGACCAGGACACACTGG - Intronic
1061053791 9:128211113-128211135 GTGAACTGGGCAGAATCCACAGG - Intronic
1061905393 9:133694174-133694196 GTGGACAGGGCAGGATGGACGGG - Intronic
1062456600 9:136642495-136642517 ATGCACTGGCCAGGAGAGACGGG - Intergenic
1203472784 Un_GL000220v1:123748-123770 GGTGACTGCCCAGGATACAGTGG - Intergenic
1189092492 X:38101252-38101274 GTGATATGGACAGGATACACAGG + Intronic
1190114856 X:47619759-47619781 GTGGTCTGGCCAGGAGCCGCGGG + Exonic
1190828755 X:54042603-54042625 GAGGGCAGGCCAGGCTACACAGG - Intronic
1194866512 X:99075360-99075382 CTGGACTGGGCAGGAGACACTGG - Intergenic
1196706912 X:118724875-118724897 GTGGAGTGGCCTAGGTACACAGG + Intergenic
1198090280 X:133322103-133322125 GTGGACTGGCCAGGATACACGGG - Intronic
1198106635 X:133468244-133468266 GTGGACTAGGCAGGCCACACAGG + Intergenic