ID: 1198090287

View in Genome Browser
Species Human (GRCh38)
Location X:133322142-133322164
Sequence TACTAACAATTAGTGACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 100}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198090278_1198090287 29 Left 1198090278 X:133322090-133322112 CCAACTAGAGTGACCCGTGTATC 0: 1
1: 0
2: 0
3: 2
4: 15
Right 1198090287 X:133322142-133322164 TACTAACAATTAGTGACACCTGG 0: 1
1: 0
2: 0
3: 11
4: 100
1198090285_1198090287 -3 Left 1198090285 X:133322122-133322144 CCACGACAGTCCTGGTTGCTTAC 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1198090287 X:133322142-133322164 TACTAACAATTAGTGACACCTGG 0: 1
1: 0
2: 0
3: 11
4: 100
1198090281_1198090287 15 Left 1198090281 X:133322104-133322126 CCGTGTATCCTGGCCAGTCCACG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1198090287 X:133322142-133322164 TACTAACAATTAGTGACACCTGG 0: 1
1: 0
2: 0
3: 11
4: 100
1198090284_1198090287 2 Left 1198090284 X:133322117-133322139 CCAGTCCACGACAGTCCTGGTTG 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1198090287 X:133322142-133322164 TACTAACAATTAGTGACACCTGG 0: 1
1: 0
2: 0
3: 11
4: 100
1198090280_1198090287 16 Left 1198090280 X:133322103-133322125 CCCGTGTATCCTGGCCAGTCCAC 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1198090287 X:133322142-133322164 TACTAACAATTAGTGACACCTGG 0: 1
1: 0
2: 0
3: 11
4: 100
1198090282_1198090287 7 Left 1198090282 X:133322112-133322134 CCTGGCCAGTCCACGACAGTCCT 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1198090287 X:133322142-133322164 TACTAACAATTAGTGACACCTGG 0: 1
1: 0
2: 0
3: 11
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198090287 Original CRISPR TACTAACAATTAGTGACACC TGG Intronic
906183968 1:43846200-43846222 TTCTAACAATTACTGACAGAGGG + Intronic
908309762 1:62868431-62868453 TACTAAAAATTAGTGTCCCGTGG - Intergenic
911043418 1:93609579-93609601 TACTAACAGTCAGAGACACAAGG + Intronic
911381341 1:97118966-97118988 TAATAATATTTAGTGACAACGGG + Intronic
912322885 1:108730869-108730891 TAAAAGCAATTAGTGCCACCGGG + Exonic
921499221 1:215880308-215880330 TACTAATAATTGGTGACAAAAGG + Intronic
1063558295 10:7101654-7101676 TACTAACAACTAATAACATCTGG + Intergenic
1066546856 10:36509415-36509437 GACAAACAATTAGTGAATCCTGG + Intergenic
1068465414 10:57383690-57383712 TACTAACAAATAGTAAGACCAGG + Intergenic
1069684935 10:70311929-70311951 TGCTAACAATTAGTGAGACGGGG - Intronic
1074878234 10:117631356-117631378 TACTTACCATTATTGTCACCAGG - Intergenic
1081509188 11:43751717-43751739 TATTAACAATTAGTGAATCCAGG - Intronic
1083575602 11:63788827-63788849 TACAAAAAATTAGCCACACCGGG + Intergenic
1085842616 11:80029879-80029901 TATTAACCATTAGTGGCACAAGG - Intergenic
1086222636 11:84467932-84467954 TGCTAACAATTATTGAATCCAGG + Intronic
1087023589 11:93627898-93627920 TGCTGACTATTAGTGACTCCTGG + Intergenic
1089756310 11:120689984-120690006 TAATTACAATAAGAGACACCTGG - Intronic
1089855636 11:121542012-121542034 TGCTAACAATTTGTGACTCTAGG - Intronic
1093462187 12:19417025-19417047 TACAAACAATTAGTCACGCATGG - Intronic
1094542744 12:31376049-31376071 TTCTATCAATTATTGACAACAGG + Intergenic
1095312556 12:40717563-40717585 TATTTACAAATATTGACACCAGG - Intronic
1098532390 12:71555639-71555661 TACTGACCATCATTGACACCTGG - Intronic
1099197446 12:79634598-79634620 AACTAACAAATAGTTACACCTGG - Intronic
1101267877 12:103110850-103110872 GACTAACAATTAGTGGTTCCAGG - Intergenic
1103390963 12:120573015-120573037 TAGTAACAATTAGTGAATCTAGG - Intronic
1108813292 13:54257477-54257499 TCCTAACAACTTGTAACACCAGG - Intergenic
1112561488 13:100519251-100519273 TCTTAACAATTAGTGAAACCAGG + Intronic
1115347127 14:32354900-32354922 AACTGACAGTTAGTTACACCAGG - Intronic
1116180952 14:41534525-41534547 TCCTAGGAATTTGTGACACCTGG + Intergenic
1118253811 14:64187453-64187475 TAGTAACAATTAGGAACATCTGG - Intronic
1124885520 15:33682230-33682252 ACTTAACAATGAGTGACACCTGG + Intronic
1125911808 15:43446747-43446769 TACGAACTAGTATTGACACCTGG + Intronic
1126404695 15:48311735-48311757 AACTAGCCATAAGTGACACCAGG + Intergenic
1126983603 15:54275664-54275686 CACCAACACTTAGTGACAACAGG - Intronic
1131592591 15:93766194-93766216 TACTACCAATCAGTGACAAAAGG - Intergenic
1133779667 16:8927979-8928001 TACAAACAATTAGCCACACATGG + Intronic
1137317626 16:47343843-47343865 TACTAAAAATAAGTGAAAGCAGG + Intronic
1137501385 16:49014136-49014158 TACTAACAATGAGACCCACCAGG + Intergenic
1140050483 16:71476606-71476628 TAAGAACAAGTAGTGACATCGGG + Intronic
1141294674 16:82756472-82756494 TACTAACAGCTAGTCACCCCGGG - Intronic
1144687450 17:17235616-17235638 TAGTAACACTTGGTGTCACCTGG - Intronic
1148632574 17:49122734-49122756 TACTAACAAAAAGTAACACACGG - Intergenic
1152192231 17:78895887-78895909 AACCAACAATTAGTAAAACCTGG + Intronic
1152780114 17:82223666-82223688 TACAAACAATTAGCCACACGTGG - Intergenic
1153380183 18:4429567-4429589 TGCCAACACTTAGTGTCACCAGG - Intronic
1155512472 18:26592053-26592075 TAGTAACAACTTCTGACACCTGG + Intronic
1156995101 18:43456103-43456125 TAATAAGAATTACTGATACCAGG - Intergenic
1157373293 18:47138503-47138525 AATTAACAATTAGTGACTTCAGG + Intronic
1158016134 18:52786376-52786398 TAAAAACAATTAGTGAGACAAGG + Intronic
1162742338 19:12780510-12780532 TACAAAAAATTAGCCACACCTGG - Intronic
925460164 2:4055254-4055276 TTCTAAAAATAAGAGACACCTGG + Intergenic
925642576 2:6000424-6000446 TGCCAGCAATTAGTGACACTGGG - Intergenic
928813703 2:35261857-35261879 TAGTAACAATTAGTAACATATGG - Intergenic
932298501 2:70646290-70646312 TACTGACATGCAGTGACACCAGG - Intronic
935038782 2:99405296-99405318 TACCCACAATTAGTTACTCCTGG - Intronic
935916816 2:107962141-107962163 TACTAACAATTAATGAGACGGGG + Intergenic
936489166 2:112955742-112955764 TTCTAACAATTCCTCACACCTGG + Intergenic
937399820 2:121572536-121572558 TACTAAAATTTATTGACAACTGG + Intronic
937926763 2:127173856-127173878 TATTAACAAGTAGTGGCTCCAGG + Intergenic
938641600 2:133286548-133286570 TATTAACAATTAGTACCACTAGG + Intronic
942296392 2:174521260-174521282 TACTAAAAATATGTGAGACCAGG - Intergenic
1168849977 20:969779-969801 TCCTGTCACTTAGTGACACCTGG - Intronic
1169845981 20:9991746-9991768 TACTATCAAATAGTCCCACCTGG + Intronic
1172149197 20:32778795-32778817 TACAAAAAATTAGCCACACCTGG + Intronic
1172194985 20:33085554-33085576 CACTAAGATTTAGTGACACTGGG - Intronic
1173893454 20:46531348-46531370 TTTTAAAAAATAGTGACACCTGG - Intergenic
1174383739 20:50173904-50173926 TTCTTAACATTAGTGACACCAGG - Intergenic
1179664679 21:42902577-42902599 TACTAGTAATTAGTGAAAGCAGG - Intronic
1181505130 22:23350314-23350336 TACTAGCAATCAGTAACAGCAGG - Intergenic
1181710436 22:24682646-24682668 TACTAGCAATCAGTAACAGCAGG - Intergenic
1181837316 22:25621501-25621523 TAAAAACAATTAGTGAGACTAGG + Intronic
949835584 3:8266279-8266301 TACCAACACTTTGTGAGACCGGG + Intergenic
957742145 3:84284260-84284282 TACTAACAATTAATGAATCTAGG + Intergenic
961413537 3:126741083-126741105 TTCTAACATTTTGTGACACCAGG - Intronic
964059914 3:152508939-152508961 TTCTAACAATTGGTGCCATCTGG - Intergenic
964452459 3:156825347-156825369 AACTACTAATTAATGACACCAGG - Intergenic
973185881 4:47327564-47327586 AGGTAACACTTAGTGACACCTGG + Intronic
978229011 4:106375347-106375369 TACTATAAATTAGAGAAACCTGG + Intergenic
984107610 4:175569241-175569263 TATAAACAATTACTGACATCTGG + Intergenic
984832760 4:183990997-183991019 TATTAAAAATCAGTGACACCAGG - Intronic
990408991 5:55521609-55521631 TACTAAGAATGAGTGAGACAAGG - Intronic
995198514 5:109400132-109400154 TACAAAAAATTAGTGAGACGTGG + Intronic
999600623 5:153259873-153259895 TACTAACTATTGGTGTCTCCTGG - Intergenic
1000357766 5:160417489-160417511 TCATAACGAATAGTGACACCTGG + Intronic
1000999051 5:167987855-167987877 TTCTAAAGATTAGTGACACCAGG + Intronic
1009672828 6:66778447-66778469 AACTAACAATTAGTTACATAGGG - Intergenic
1009852895 6:69220388-69220410 TACTAAAAATTAGCCACTCCTGG + Intronic
1011499380 6:87970986-87971008 TACTGACAATAACTGACATCAGG + Intergenic
1012141836 6:95635144-95635166 TAAATACTATTAGTGACACCTGG - Intergenic
1017433832 6:154397099-154397121 AACTAACAATTAGTGAGGCCGGG - Exonic
1019832927 7:3350952-3350974 TAAACACAATTAGTGACATCTGG + Intronic
1020398354 7:7744571-7744593 CAGTAACAATTAGTGTTACCAGG - Intronic
1023075305 7:36475872-36475894 TATTAACAACTATTGACACTTGG - Intergenic
1024790924 7:52964172-52964194 TACTAAAAAACAGTGACAACAGG + Intergenic
1025970919 7:66324641-66324663 TACTAAAAATTAGCCAAACCTGG + Intronic
1026325308 7:69304498-69304520 TACTTACAATTAAACACACCAGG + Intergenic
1028694536 7:93693399-93693421 TAATAATAATTAGTCACAGCTGG - Intronic
1031404606 7:121369279-121369301 TACTTATAAATTGTGACACCAGG - Intronic
1033207341 7:139434354-139434376 TACTCCCAACCAGTGACACCCGG + Intergenic
1035052876 7:156013184-156013206 AACTAAAAACAAGTGACACCAGG - Intergenic
1048212874 8:132470384-132470406 TATTAACAATTGGTGAAGCCAGG - Intronic
1050169120 9:2797097-2797119 CACTGACTATAAGTGACACCCGG + Intronic
1052674017 9:31595995-31596017 TACTACCAATTGGTGAATCCAGG - Intergenic
1055110974 9:72559248-72559270 TACAAAAAATTAGTGAGGCCTGG - Intronic
1055841423 9:80509498-80509520 TACTAACAAATAGTTACAGCAGG - Intergenic
1190567637 X:51746987-51747009 AACTAAGGATTAGTGACTCCTGG + Intergenic
1191243395 X:58206928-58206950 TTCTAAAAAATAGAGACACCTGG + Intergenic
1191953829 X:66623059-66623081 TGCCAAAAAATAGTGACACCTGG + Intronic
1192621907 X:72685174-72685196 AACTAACAAATAGTGGAACCGGG + Intronic
1197178783 X:123512133-123512155 TACAAACTATTACTGACAACTGG + Intergenic
1198090287 X:133322142-133322164 TACTAACAATTAGTGACACCTGG + Intronic
1200095552 X:153658337-153658359 TACAAAAAATTAGTCACACGTGG - Intergenic