ID: 1198090400

View in Genome Browser
Species Human (GRCh38)
Location X:133323021-133323043
Sequence GGGATCTGAGCAAGATTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198090400_1198090405 22 Left 1198090400 X:133323021-133323043 CCTTGAAATCTTGCTCAGATCCC 0: 1
1: 0
2: 0
3: 20
4: 164
Right 1198090405 X:133323066-133323088 CAAAGATTCTCTGGTGGAACTGG 0: 1
1: 0
2: 0
3: 16
4: 131
1198090400_1198090406 23 Left 1198090400 X:133323021-133323043 CCTTGAAATCTTGCTCAGATCCC 0: 1
1: 0
2: 0
3: 20
4: 164
Right 1198090406 X:133323067-133323089 AAAGATTCTCTGGTGGAACTGGG 0: 1
1: 0
2: 1
3: 13
4: 153
1198090400_1198090404 16 Left 1198090400 X:133323021-133323043 CCTTGAAATCTTGCTCAGATCCC 0: 1
1: 0
2: 0
3: 20
4: 164
Right 1198090404 X:133323060-133323082 AGAAAGCAAAGATTCTCTGGTGG 0: 1
1: 0
2: 3
3: 40
4: 357
1198090400_1198090403 13 Left 1198090400 X:133323021-133323043 CCTTGAAATCTTGCTCAGATCCC 0: 1
1: 0
2: 0
3: 20
4: 164
Right 1198090403 X:133323057-133323079 CAAAGAAAGCAAAGATTCTCTGG 0: 1
1: 0
2: 5
3: 39
4: 461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198090400 Original CRISPR GGGATCTGAGCAAGATTTCA AGG (reversed) Intronic
900887248 1:5423697-5423719 GGGATCTGGGCAGGATGTCCAGG + Intergenic
901209023 1:7514168-7514190 GAGATCTGAGCCAGATGTGAGGG - Intronic
903010442 1:20326326-20326348 GGGATCTCAGCATGGCTTCAGGG - Intronic
904235872 1:29116704-29116726 GGGATGTGAGCAGGTTTACAGGG - Intronic
905271645 1:36791364-36791386 GGGAACGGAGCAAGTTTTCAGGG + Intergenic
905318542 1:37099116-37099138 GGGATGTGAGTAAGATATCTGGG + Intergenic
908006195 1:59731818-59731840 GGGATCAGAGCCAGATTCCAGGG - Intronic
910024721 1:82636173-82636195 TGGATCTGAGAAAGATTTGTAGG - Intergenic
910496313 1:87832535-87832557 GAGATCTGAGAAGGATGTCAGGG + Intergenic
911401562 1:97381444-97381466 GGGCTCTGTGGAAGATTTCATGG + Intronic
912323114 1:108733124-108733146 TAGATCAGAGCAAGATTTGAAGG - Intronic
914340805 1:146758611-146758633 TGGGTCAGAACAAGATTTCATGG - Intergenic
915634913 1:157179292-157179314 AGGACCTGAGCAGCATTTCAGGG - Intergenic
917210848 1:172630633-172630655 GGGATCTGAGGAACCTCTCAGGG + Intergenic
918658042 1:187053593-187053615 GGGATCTGAGTAAGAAATGATGG + Intergenic
920269094 1:204749920-204749942 GGGCCCTGGGCAAGATTTCTGGG + Intergenic
921601655 1:217112529-217112551 AGGATCTGACTAAGATTTCCAGG + Intronic
1063240357 10:4163112-4163134 GACATGTGAGCAGGATTTCAGGG - Intergenic
1067692789 10:48512902-48512924 GGTATATGAGCAAGTTCTCAAGG - Intronic
1068262375 10:54599589-54599611 AAGATCTGACAAAGATTTCATGG + Intronic
1070920862 10:80185229-80185251 TAGATCTGAGCAAGACTTCTGGG - Intronic
1071189908 10:83087955-83087977 GGGAGCTTAGCAAGATCTCAGGG + Intergenic
1072022362 10:91414822-91414844 GGGAGGTGAGAAAGATTGCATGG + Intronic
1073685243 10:105745284-105745306 GGGAACTGAGCACAATCTCATGG + Intergenic
1073926771 10:108525589-108525611 GGGATATGAGAAACATGTCAGGG + Intergenic
1074005955 10:109423630-109423652 GGGAGCTGTGAAAGATTTTAGGG - Intergenic
1074944461 10:118268018-118268040 GGGATCTGAGAAGGTTTACAGGG + Intergenic
1075471037 10:122689559-122689581 GGGATCTCAGCCAGGTTTCTAGG - Intergenic
1078395304 11:10976162-10976184 GGTATCTGAGCTATATTCCAAGG - Intergenic
1084332049 11:68436276-68436298 GGGAACTGAGCAAGTTCTCTGGG + Intronic
1085390973 11:76182032-76182054 GGGAAATCAGGAAGATTTCATGG - Intergenic
1085554475 11:77407509-77407531 AGCATCTGAGCAATTTTTCACGG + Intronic
1085815960 11:79737770-79737792 GCAATCTGAGTAAGATCTCAAGG - Intergenic
1090794223 11:130120658-130120680 CGGATCTGACCATGATTTCAAGG - Intronic
1092912724 12:13162197-13162219 GGGAGGTGAGCAAAATCTCAGGG + Intergenic
1094064548 12:26349517-26349539 TAGATTTGAGCAATATTTCAAGG - Intronic
1094148461 12:27255800-27255822 GGGACCTGAGCAAGATATACCGG - Intronic
1096779272 12:53982912-53982934 GGGATCAGAGAAAGGTTTCCAGG - Intergenic
1099633040 12:85175146-85175168 GCTTTCTGAGCAAGATTGCAAGG - Intronic
1100040505 12:90311746-90311768 GGGAACTGATTAATATTTCATGG + Intergenic
1100048841 12:90419191-90419213 GGTATCTGAGAGAGATTCCATGG - Intergenic
1106316961 13:28602826-28602848 GGGACCTGAACAATATATCATGG - Intergenic
1106385454 13:29281201-29281223 GTGAAATGAGCGAGATTTCAGGG + Intronic
1108156985 13:47595305-47595327 GGGATTTGAACAATATTGCATGG - Intergenic
1109052455 13:57501372-57501394 GGGATTAGAGATAGATTTCATGG - Intergenic
1111812896 13:93114215-93114237 TGGATCTGAGCAAAGTTTTACGG + Intergenic
1113848796 13:113406561-113406583 TGGAACTGAGCAAGCTTTCAGGG - Intergenic
1117183176 14:53213346-53213368 TGGATCTGAGCAAAATTTGGGGG - Intergenic
1119074374 14:71621270-71621292 GGGAGATGAGGAAGCTTTCAAGG - Intronic
1120476844 14:84999093-84999115 GAGATCTGAACAAGCTTTAAAGG + Intergenic
1126342796 15:47661889-47661911 GTGATCTGTGCAAGATATCTAGG - Intronic
1126961200 15:53996595-53996617 GGGATATGAGAAAGCTTTCTAGG - Intergenic
1129944170 15:79524682-79524704 GGCCTCTGAGCAAGATTTCTGGG + Intergenic
1131359440 15:91777017-91777039 GGGATCCCAGCAAGATGTCCTGG + Intergenic
1131670490 15:94614688-94614710 AGGATCTGAGAAATGTTTCAAGG + Intergenic
1138888711 16:61114527-61114549 GGGATCTGGGTAATATATCACGG + Intergenic
1139953401 16:70682409-70682431 GAGATCTTAGCAAGGTTTCAAGG - Intronic
1139993478 16:70958795-70958817 TGGGTCAGAACAAGATTTCATGG + Intronic
1140973340 16:80035224-80035246 GGGATATGAGCAAAATTTTAGGG - Intergenic
1143682382 17:8487013-8487035 GTGATCTCTGCAAGAGTTCATGG - Intronic
1144785363 17:17828279-17828301 GGCATCAGAGCAAGTTTTGATGG - Intronic
1147664670 17:42138994-42139016 GGGATCAGGGAAGGATTTCATGG - Intronic
1147975223 17:44243780-44243802 AAGATTTAAGCAAGATTTCAAGG + Intergenic
1148249006 17:46058162-46058184 GGGATCTTATGAAGATTTCTGGG - Intronic
1153301477 18:3595714-3595736 GGAATGTGATCAGGATTTCACGG + Intronic
1159367447 18:67486855-67486877 GGGATCTGAGTTTTATTTCAAGG + Intergenic
1161732111 19:5967522-5967544 GGGATATGAGGAGGATGTCATGG - Intronic
1161881362 19:6955864-6955886 GGGCTCTGAGTAAGATGACAAGG - Intergenic
1163578338 19:18123494-18123516 GGGATCTGAGCCAGGGTTGAGGG - Intronic
1165525342 19:36349818-36349840 TGGATTTGAAGAAGATTTCAAGG + Intronic
1166130291 19:40742004-40742026 GGGATTTGAACAACACTTCAGGG + Exonic
925196915 2:1933098-1933120 TGGATCTGAGGAGGAGTTCAAGG + Intronic
925938830 2:8795187-8795209 GGAATCTGGGCAAGAAATCAAGG - Intronic
926135524 2:10333006-10333028 GGGCTCTGTGGGAGATTTCAGGG + Intronic
926468780 2:13227042-13227064 GGTGTTTGAACAAGATTTCAGGG - Intergenic
927500931 2:23582691-23582713 GGGATTTAAGCTATATTTCAGGG + Intronic
928325670 2:30317583-30317605 GGTAACAGAGCAAGATGTCAGGG + Intronic
930624935 2:53686484-53686506 GGGAACTGAACAAGATTAGAAGG - Intronic
930797879 2:55411882-55411904 GTGATAGGAGCAAGATTTCATGG - Intronic
932582053 2:72998537-72998559 GGCAGCTGAGCAAGAGCTCAGGG + Intronic
932781060 2:74558761-74558783 GGCATCTGAGGAAGATTTGCTGG + Exonic
932894901 2:75630314-75630336 GTGATCTGAGCAAAATCTGAAGG - Intergenic
933393917 2:81707817-81707839 GGAATCTAGGGAAGATTTCATGG - Intergenic
934606896 2:95702183-95702205 GGGGACTCAGCAAGACTTCAGGG + Intergenic
935693572 2:105751239-105751261 GGGAGCTGAGGGAGAATTCAAGG - Intronic
937181366 2:119998673-119998695 GTGATTTCAGCAAGTTTTCAGGG - Intergenic
943530764 2:189077319-189077341 GGGATCTGAGAAAGAATGTATGG + Intronic
945048789 2:205804465-205804487 GGGACCTTACCAAAATTTCAGGG + Intergenic
945914604 2:215690048-215690070 GGAATGTGAGAAAGACTTCAAGG + Intergenic
946696236 2:222362547-222362569 GGGAAATGAGCCAGATTACATGG + Intergenic
1171992253 20:31705661-31705683 GGGATCTGAGAAGGGTTTAAAGG + Intronic
1174311436 20:49658436-49658458 GGGATGAAAGGAAGATTTCAGGG - Intronic
1175940106 20:62533870-62533892 GGGATCTGATAAAGCTTCCAGGG + Intergenic
1176056232 20:63150683-63150705 GGGATCAGAGCAGGATCCCATGG + Intergenic
1176969505 21:15249413-15249435 GGTATCTGAGATAGAATTCAGGG + Intergenic
1177426528 21:20930288-20930310 GTGATCTGAGTAAAATTTCATGG - Intergenic
1179123334 21:38569033-38569055 GGGGTCTGGGCAGGATCTCAGGG - Intronic
1179582586 21:42352761-42352783 GGGGCCTGAGCAGGATTCCAGGG - Intergenic
1181542907 22:23583560-23583582 GGGATCTGAGCATCAGTCCATGG - Intergenic
954342615 3:49967692-49967714 GGGACCTGGACATGATTTCAGGG + Exonic
955466247 3:59240040-59240062 GTGAAATTAGCAAGATTTCAAGG - Intergenic
955709774 3:61766332-61766354 GGGATGTGAGAAAGAATCCAGGG - Intronic
958127725 3:89379698-89379720 GGCTTCTCAGAAAGATTTCATGG + Intronic
959105450 3:102059644-102059666 GGAATTTGAGCAAAATGTCATGG + Intergenic
959822001 3:110746528-110746550 GGGAACTGGCAAAGATTTCATGG + Intergenic
960449617 3:117790428-117790450 GGGAGCTTAGCAAGCTATCAGGG + Intergenic
964683793 3:159371401-159371423 AGGGACTGAGGAAGATTTCACGG + Intronic
965400439 3:168206566-168206588 GGGATCCCAGCCAGTTTTCAGGG + Intergenic
966587445 3:181643461-181643483 AGGGTTTGAGCAAGAGTTCAAGG + Intergenic
967662955 3:192135574-192135596 GTGATCTGACCAAGATTTCTTGG + Intergenic
967673614 3:192269480-192269502 AGGAACTGAGCAAGATTGCAGGG - Intronic
968743543 4:2344217-2344239 GAGATCTGGGGAAGGTTTCAAGG + Intronic
969126086 4:4949295-4949317 GGGCTGTGATGAAGATTTCAGGG - Intergenic
969319143 4:6400921-6400943 GGGAGTTGAGGAACATTTCAAGG + Intronic
969425151 4:7119979-7120001 CAGATCTGAGGCAGATTTCAGGG - Intergenic
969871910 4:10109934-10109956 GGGATCAGTGTAAGATTTAACGG - Intronic
970226348 4:13861532-13861554 GGGATGTGAGGGAGAATTCAAGG - Intergenic
971734978 4:30436549-30436571 GGGATATGAGCAAGCTGTCATGG + Intergenic
971850159 4:31975123-31975145 GGTATCTCAGCAAACTTTCAGGG - Intergenic
974213563 4:58815268-58815290 GATATCTGAGCCAAATTTCAAGG - Intergenic
975374091 4:73622118-73622140 TGGATTTGAGCAAGATATCCTGG - Intergenic
975989413 4:80241867-80241889 GGGTTCTGAGCAAAATTACATGG - Intergenic
979484067 4:121250623-121250645 GGCACCTGAGATAGATTTCAAGG - Intergenic
979994274 4:127411701-127411723 GGAATCTGAGGGTGATTTCATGG - Intergenic
981154229 4:141414910-141414932 TGGATTTGACCCAGATTTCAAGG + Intergenic
984544183 4:181079501-181079523 GTGATCTGTCCAAGATTACAGGG + Intergenic
986802396 5:11275662-11275684 GGGAACTGAGAAAGGTTTAAGGG - Intronic
987577719 5:19752482-19752504 GGGATGAGGGCAAGATTTCCAGG - Intronic
989635151 5:43524014-43524036 GGGTTCTGAGCAAGCTATAAGGG + Intergenic
991690681 5:69222336-69222358 GGGATAGGAGGGAGATTTCATGG + Intronic
993651077 5:90522838-90522860 GTGATGTGAAGAAGATTTCAAGG - Intronic
993736054 5:91477638-91477660 GGGCTCAGAGCAAGAGGTCAGGG - Intergenic
994610773 5:102036694-102036716 GGGACCTCAGGAAGTTTTCATGG - Intergenic
996441247 5:123493377-123493399 GGGAGCTCAGAAAGATTACAGGG + Intergenic
998205849 5:140156332-140156354 GGGTTCTGAGAGAGAATTCATGG - Intergenic
998327428 5:141293970-141293992 GGGTGCTGAGCAAGTTTCCATGG - Intergenic
999800463 5:155028795-155028817 GGCAGCTGAGCAAGAGTACAGGG + Intergenic
1003678944 6:8233192-8233214 GGGCTCTCAACAAAATTTCAAGG - Intergenic
1003692921 6:8372546-8372568 GTGATTTGAGCCAGATTTCAAGG - Intergenic
1005397630 6:25399454-25399476 TGGATATGAGGCAGATTTCAGGG + Intronic
1006188574 6:32193978-32194000 GAGATCTGCCCAAGATTGCAAGG - Intronic
1008048304 6:46873965-46873987 GGGGTCTGAGCAAGTTACCATGG - Intronic
1008619271 6:53255816-53255838 ATGATTTGAGCAAGATTGCACGG + Intergenic
1010262362 6:73831383-73831405 GGGAACTGAGGATGATGTCAAGG - Intergenic
1012448495 6:99330797-99330819 GGGATCTGACCAAAATTTGTAGG - Intronic
1013622366 6:111902302-111902324 AAGATCTGAGCAAGATTTACTGG - Intergenic
1014573848 6:123045567-123045589 TGTACCTGAGCAAGATTTAAGGG - Intronic
1014689184 6:124541235-124541257 GGGAACTGTGCAATATTTTAGGG + Intronic
1017078540 6:150643317-150643339 AGAATCTGGGCTAGATTTCATGG - Intronic
1017907689 6:158768182-158768204 GGGTTCTGAGCAAGAGCTGATGG + Intronic
1018380996 6:163258369-163258391 GGGCTTAAAGCAAGATTTCAGGG + Intronic
1018627487 6:165793524-165793546 GGGATTGCAGGAAGATTTCAGGG - Intronic
1018782332 6:167079505-167079527 GGGATCTGTGCTATATTTAAAGG - Intergenic
1019083643 6:169454306-169454328 GGTATCTGAGAAAGATTTCTTGG + Intergenic
1024282710 7:47732682-47732704 AGGATCAGAACAAAATTTCAGGG - Intronic
1027651962 7:80879270-80879292 GGCATCTGAGCAGGACTTCCTGG + Intronic
1031604857 7:123756404-123756426 GTGATTTTAGTAAGATTTCATGG - Intergenic
1032458623 7:132092987-132093009 AGGATCCAAGCCAGATTTCAGGG - Intergenic
1032886858 7:136149900-136149922 AGCATCTGATCAAAATTTCAAGG - Intergenic
1033483683 7:141766806-141766828 ACGGTCTGAGCAAGATTTCCAGG + Intronic
1035391385 7:158507051-158507073 GGGCTCTGAGCTAGGTTTGAAGG + Intronic
1036045022 8:5130208-5130230 GGGACATGAGGAAGATTTCAGGG + Intergenic
1037410259 8:18588358-18588380 AGGATCTGTGCAAGGTTTCCAGG + Intronic
1039261056 8:35772514-35772536 GGCATCAGGGCAGGATTTCAGGG + Intronic
1043777860 8:84292906-84292928 GTGATGTGAGAAAGAATTCAGGG - Intronic
1044514002 8:93117326-93117348 GGGCTCTAAGCTAGATTTGAAGG - Intergenic
1045092874 8:98765040-98765062 GAAATCTGAACAAGATTTGAGGG + Intronic
1050346088 9:4689141-4689163 AGCATCTGAGCTTGATTTCAAGG + Intronic
1051330450 9:16019806-16019828 TGGTTCTGAGCATGATTTCAAGG + Intronic
1051780797 9:20686435-20686457 TGGACCTGATCAAGATTGCAAGG + Intronic
1055789048 9:79901637-79901659 GGGGTCTGGGCCATATTTCAGGG + Intergenic
1059068089 9:111106137-111106159 GGGTTCTGGCCAAGATTTTAAGG + Intergenic
1059573131 9:115461701-115461723 AGGTTTTGAGCAAGATATCAGGG + Intergenic
1061270871 9:129541313-129541335 GGGTTCAGAGCAATATTACAGGG - Intergenic
1062295351 9:135822401-135822423 GGAAGCCGAGCACGATTTCATGG - Exonic
1187049439 X:15681026-15681048 GGGAACTGATCAAAGTTTCAGGG + Intergenic
1189224680 X:39402938-39402960 GGGCGCTGAGTAAGATGTCAAGG - Intergenic
1189865965 X:45327416-45327438 CGGATTTGAGCAAGATATCCTGG - Intergenic
1193098055 X:77575981-77576003 GAGCACTGAGCAAGATTTAAGGG - Intronic
1198090400 X:133323021-133323043 GGGATCTGAGCAAGATTTCAAGG - Intronic
1198935455 X:141898866-141898888 GGCTTCTGAGCAACACTTCAAGG - Intergenic
1199263630 X:145804811-145804833 AGGATCTGGCCAAGATTTCATGG + Intergenic
1202266431 Y:23023378-23023400 GGGATCAGATCAAGAGGTCAAGG + Intergenic
1202419424 Y:24657121-24657143 GGGATCAGATCAAGAGGTCAAGG + Intergenic
1202451362 Y:25012963-25012985 GGGATCAGATCAAGAGGTCAAGG - Intergenic