ID: 1198091547

View in Genome Browser
Species Human (GRCh38)
Location X:133335985-133336007
Sequence GAAGTTGCACAGAGACAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 266}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198091547_1198091549 -8 Left 1198091547 X:133335985-133336007 CCCAGCTGTCTCTGTGCAACTTC 0: 1
1: 1
2: 0
3: 18
4: 266
Right 1198091549 X:133336000-133336022 GCAACTTCACTGCTCCATCTTGG 0: 1
1: 0
2: 1
3: 22
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198091547 Original CRISPR GAAGTTGCACAGAGACAGCT GGG (reversed) Intronic
900616148 1:3566557-3566579 GACGCTGCCCAGAGACAGGTGGG - Intronic
901819092 1:11814709-11814731 GAAGAGGCACAGATTCAGCTTGG - Intronic
902891499 1:19447647-19447669 TGAGTTGCACAGATACACCTGGG + Intronic
903404910 1:23088186-23088208 GAAGGTGAGCAGAGAGAGCTGGG + Exonic
904120154 1:28192935-28192957 GAAGCAGCACTGAGACAGCTGGG + Intronic
904408835 1:30312594-30312616 GCAGTTGCTCAGAGACTGTTAGG + Intergenic
904571064 1:31465587-31465609 GAAATAGCAGAGAGACAGTTTGG - Intergenic
909024041 1:70462876-70462898 AAAGTTGCACAGAGCCATGTGGG - Intergenic
909085691 1:71167702-71167724 GAAGCTGCACAGATCCTGCTTGG + Intergenic
911666216 1:100556219-100556241 GAAGATGCAGAGAGAGAGATTGG - Intergenic
911779098 1:101852915-101852937 GAAGCAGCACAGTGGCAGCTGGG - Intronic
917508360 1:175649265-175649287 GAAGGTGGAGAAAGACAGCTTGG - Intronic
919552623 1:199010677-199010699 GAAGTTGCACAGCAAAAGCCAGG + Intergenic
921155943 1:212438898-212438920 GAAGTGACACAGAAACAGCCAGG - Intronic
921925325 1:220706217-220706239 GAAGATGCCCAGATTCAGCTAGG - Intergenic
923242707 1:232101086-232101108 GAAGGTGCACAGACAAAGGTTGG + Intergenic
923558126 1:235017853-235017875 GAAGTTACTCAGAGATAGCAAGG - Intergenic
924477446 1:244394600-244394622 GAAGCAGCACAGGGGCAGCTTGG + Intergenic
1063156604 10:3385079-3385101 GAAGTCTCATACAGACAGCTTGG - Intergenic
1064756533 10:18576563-18576585 GATGTAGCAGAGAGAGAGCTTGG - Intronic
1065358899 10:24870401-24870423 AAATTTGCACATAGACGGCTGGG - Intronic
1066048795 10:31617366-31617388 CCAGTTTCACAGACACAGCTGGG + Intergenic
1066808604 10:39293215-39293237 GAATCTGCACAGATATAGCTGGG - Intergenic
1067471106 10:46538729-46538751 GAAATTGTACAGAGATAGTTTGG + Intergenic
1067687149 10:48472647-48472669 GAAGCAGCACAGAGGCAGATGGG - Intronic
1070213701 10:74353191-74353213 AATGTTGCACAGAGACACCATGG + Intronic
1070538785 10:77401088-77401110 GGTGTTGTACAGAGAGAGCTGGG - Intronic
1072900437 10:99402311-99402333 GAAGTGGCTCAGAGCCAGCTGGG - Intronic
1074114740 10:110447295-110447317 GAAGGGACACAGAGTCAGCTAGG + Intergenic
1074404403 10:113168782-113168804 GAAAATGCACATAAACAGCTTGG - Intergenic
1076447160 10:130524567-130524589 CAAGGTGCACAGGGAAAGCTAGG - Intergenic
1076662686 10:132065803-132065825 TAAGGTGCACAGGGAGAGCTTGG + Intergenic
1077239092 11:1501390-1501412 GCAGTTGCACAGTGACATCCAGG + Intergenic
1077609372 11:3635079-3635101 GAAGTAGAACAGATACAGCTTGG - Intergenic
1077930133 11:6722294-6722316 GAAGTGACACAGAGACAGGAAGG - Intergenic
1079421634 11:20296404-20296426 GAAGTTCCACAAATAGAGCTGGG - Intergenic
1080704696 11:34679451-34679473 GCATGTGCACAGAGACAGCCTGG - Intergenic
1083757991 11:64801709-64801731 GAAGATCCACAGAGACATCAAGG - Exonic
1084529599 11:69719116-69719138 GACCTTGGACAGAGGCAGCTTGG + Intergenic
1085047279 11:73360868-73360890 GAAGATCCACAGAGACCTCTGGG + Intronic
1085204876 11:74725538-74725560 GAACTTGGATAGAGACAGTTTGG - Intronic
1085238465 11:75032800-75032822 GGACTTGCACAGAGACAGAGAGG + Intergenic
1085381469 11:76123148-76123170 GAGGTGGCACAGAGACAGGAGGG - Intronic
1085651262 11:78270819-78270841 GAGGTTGCACAGGTAAAGCTTGG - Intronic
1086923041 11:92609217-92609239 GAAGTGGCACAGAGACACAATGG - Intronic
1089282681 11:117385445-117385467 GAACTTGCACAGAGGCAACCTGG - Intronic
1090349896 11:126101266-126101288 GCAGTTGGGCACAGACAGCTTGG + Intergenic
1090549218 11:127801207-127801229 GAAGTTACACAGAGACTGCGTGG - Intergenic
1091880585 12:3974204-3974226 GAAGTGCCACAGGGACAGCTTGG + Intergenic
1091991981 12:4962851-4962873 TATTTTGCACAGAGACAGGTGGG - Intergenic
1094113456 12:26884905-26884927 GCAGGTGCACAGAGAGAGTTGGG + Intergenic
1097172273 12:57122946-57122968 GAAGTTGCACAGGGTGAGATAGG + Intronic
1100362942 12:93894747-93894769 GCTGTTGCTCAGAGACACCTGGG + Intronic
1102153616 12:110706225-110706247 GAAGTAACACAGAGCCAACTAGG - Intergenic
1102606482 12:114071563-114071585 GATATAGCAGAGAGACAGCTTGG - Intergenic
1103556182 12:121768001-121768023 GAAGTTGCAGAGAGACCTCCTGG + Intronic
1105259864 13:18771012-18771034 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105262544 13:18790335-18790357 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105264465 13:18803791-18803813 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105809309 13:23980261-23980283 GTAGTTGCACAAAGCCAGCCTGG + Intronic
1106134164 13:26961908-26961930 GAAGGTGCACAGAGGCAGCATGG - Intergenic
1107140451 13:36993012-36993034 GAAGATGCACAGCCTCAGCTGGG + Intronic
1107609832 13:42102147-42102169 GGAGTTGCAAGGAGACTGCTTGG + Intronic
1107843825 13:44489920-44489942 GAACATTCACAGACACAGCTAGG + Intronic
1109004607 13:56856322-56856344 GAAGTTTCACAGTGTTAGCTAGG - Intergenic
1109139744 13:58699593-58699615 GAAGAAGAACAGAAACAGCTTGG + Intergenic
1112364539 13:98745551-98745573 AAAGTGACACAGAGACAGATGGG + Intronic
1113075309 13:106462205-106462227 GAAGTTGCAGAGAGACAGCTTGG + Intergenic
1113093691 13:106640647-106640669 AAAGTGACACAGAAACAGCTGGG - Intergenic
1113197832 13:107830110-107830132 GAAATGGGCCAGAGACAGCTGGG - Intronic
1118068149 14:62214896-62214918 GAAGTGGCTCAGAGAGAGATGGG - Intergenic
1122277476 14:100602196-100602218 TAAGTTGCTCAGAGACAGTTTGG + Intergenic
1122298000 14:100716284-100716306 GAAGCTGCCCAGAGACAGGTGGG - Intergenic
1122326255 14:100882353-100882375 GAAGTTTCGCAGAGATAGCTTGG + Exonic
1202833982 14_GL000009v2_random:64277-64299 AAAGATGCACAGGTACAGCTTGG + Intergenic
1123938712 15:25206453-25206475 GGAGGAGCACAGAGACAGGTTGG - Intergenic
1123942939 15:25225394-25225416 GGAGGAGCACAGAGACAGGTTGG - Intergenic
1125972221 15:43921154-43921176 GAAATTGCTCAGAAACAACTGGG + Intronic
1128150725 15:65362099-65362121 GAAGTGGTACAGAGGGAGCTGGG + Intronic
1128451581 15:67808916-67808938 GCAGGTGCTCAGAGAAAGCTGGG - Intergenic
1128704097 15:69826020-69826042 AAAATTGGAAAGAGACAGCTGGG - Intergenic
1129314806 15:74735227-74735249 GATGCTGCCCAGAGAAAGCTGGG + Intergenic
1132029269 15:98427223-98427245 GAGGTTGAACTGAGATAGCTGGG - Intergenic
1132052137 15:98615990-98616012 GAAGCTGCACAAATACAGGTTGG - Intergenic
1133960992 16:10493270-10493292 GATATAGCAGAGAGACAGCTTGG - Intergenic
1134896288 16:17889780-17889802 CAAGATGCACAGACAGAGCTTGG - Intergenic
1135179554 16:20260929-20260951 GAAGTGGCACTGAGCTAGCTGGG + Intergenic
1137949045 16:52764579-52764601 GAGGTTGCACAGAGACAGGCAGG + Intergenic
1139020041 16:62737480-62737502 CAAATTGGAAAGAGACAGCTAGG - Intergenic
1139272474 16:65697226-65697248 TGAGTTGCACAGATTCAGCTGGG - Intergenic
1139656081 16:68387944-68387966 GAATTTGCACAGAAAAGGCTTGG + Intronic
1140206876 16:72940350-72940372 GAAGCTGCACAGGGAAATCTGGG + Intronic
1140743278 16:77960479-77960501 CAGATTGCACAGAGAAAGCTAGG + Intronic
1141499164 16:84431784-84431806 AAAGTGTCACAGAGACAGCCTGG - Intronic
1141996143 16:87637577-87637599 GAAGTTGTAAAGACAAAGCTGGG + Intronic
1142681902 17:1554937-1554959 GGAGAGGCACAGGGACAGCTTGG - Intronic
1143971292 17:10797831-10797853 GAAGCAGCAGAGAGACAGCAAGG - Intergenic
1145905450 17:28513853-28513875 GAAGGTGCCCAGAGGCAGCCAGG + Intronic
1147531223 17:41280085-41280107 TAGGTTGCACAAAGACAGGTAGG + Intergenic
1149469770 17:56906802-56906824 GAAGTTGCACAGTGAAAGATTGG - Intronic
1150138582 17:62710013-62710035 GAAGTTGCAAGGAGCAAGCTGGG - Intronic
1150271724 17:63871109-63871131 AAAATTGCTCACAGACAGCTTGG + Intergenic
1150275272 17:63894006-63894028 AAAATTGCTCACAGACAGCTTGG + Intergenic
1150277402 17:63908694-63908716 AAAATTGCTCACAGACAGCTTGG + Intergenic
1152529521 17:80909090-80909112 GGAGCTGCACAGACACAGTTTGG - Intronic
1152850205 17:82629394-82629416 GAGGTTCCACAGAGAGAGCAGGG - Intronic
1154423924 18:14257770-14257792 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154425258 18:14267223-14267245 AAAGATGCACAGGAACAGCTTGG + Intergenic
1154427992 18:14286811-14286833 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154428893 18:14293379-14293401 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154432954 18:14322462-14322484 AAAGATGCACAGGAACAGCTTGG + Intergenic
1154433847 18:14329023-14329045 AAAGATGCACAGGTACAGCTTGG + Intergenic
1155001101 18:21687504-21687526 GAAGTTTAACAGAGGCGGCTGGG - Intronic
1157400170 18:47380769-47380791 GAAGTGGCACAGACACAATTGGG - Intergenic
1157456841 18:47838792-47838814 TAGGTTCCACAGAGACACCTTGG - Exonic
1157659890 18:49431821-49431843 GATGATGCACATGGACAGCTGGG + Intronic
1158543756 18:58378806-58378828 GAAGCTGCTGAGAAACAGCTTGG - Intronic
1158958554 18:62566690-62566712 GACGTTGGTCAGAGACAGTTAGG + Intronic
1159527826 18:69616388-69616410 GAAGGAGCACAGGGCCAGCTAGG - Intronic
1159529012 18:69631476-69631498 GAGGTTGAACAGTGACAGATGGG - Intronic
1165284882 19:34833266-34833288 GGAGAGGCACAGAGACAGCGAGG - Intergenic
1166821648 19:45584233-45584255 GAAGTTGCCCAAGGACAGCCGGG + Intronic
1167131053 19:47586187-47586209 CCAATTGCACAGAGACAGCAGGG - Intergenic
1202638700 1_KI270706v1_random:63415-63437 AAAGATGCACAGGTACAGCTTGG - Intergenic
925207629 2:2020917-2020939 GGAGCTGCTCAGAGGCAGCTGGG - Intronic
925758780 2:7163399-7163421 GAAGTTGAACAAAGATAGATGGG - Intergenic
927155122 2:20216896-20216918 GAAGATCCACAGAGAGAGCCAGG + Intronic
927849638 2:26490819-26490841 GAAGTTGCAATGAGACACCCTGG + Intronic
928752175 2:34483411-34483433 GAATTTGCACAAAGAAAGCATGG + Intergenic
929294037 2:40226250-40226272 GAAGTTGCACAAATCCAGCAAGG - Intronic
930963863 2:57295505-57295527 GAAGTTGGACATAGCCTGCTGGG - Intergenic
930986965 2:57601373-57601395 GAATTAGCACAGATACTGCTGGG + Intergenic
931088856 2:58864439-58864461 AAAGTTGCCCAGAGGCAGATGGG + Intergenic
931248748 2:60512232-60512254 GCAGTTCCACAGTGACAGGTGGG - Intronic
932716269 2:74102215-74102237 AAAGCACCACAGAGACAGCTCGG - Exonic
934491820 2:94766345-94766367 AAAGATGCACAGGTACAGCTTGG - Intergenic
934492268 2:94769491-94769513 AAAGATGCACAGGCACAGCTTGG - Intergenic
934494159 2:94782933-94782955 AAAGATGCACAGGTACAGCTTGG - Intergenic
935857434 2:107290190-107290212 GTAGTTTCACAGAGAAAGCCAGG - Intergenic
937132978 2:119527098-119527120 GAGGTTCCACAGAGAAAGCCTGG - Intergenic
939480243 2:142739287-142739309 GAAGTTGCTGAGAGAAATCTTGG + Intergenic
940747159 2:157580891-157580913 AAAGTTCTACAGAGACAGATAGG + Intronic
941148454 2:161883775-161883797 GAAGACACACAGAGACAACTGGG - Intronic
944465581 2:199996712-199996734 GAAGTGTCACATAGACACCTTGG - Intronic
946818024 2:223599018-223599040 GAAGGGGGACAGAGACACCTTGG + Exonic
948017721 2:234703399-234703421 GAAGCTGAATAGAGACAGCTTGG - Intergenic
948626459 2:239272021-239272043 AAGGTTTCACAGAGAGAGCTGGG - Intronic
1168940570 20:1707726-1707748 GATGGTGCACAGAGAGGGCTGGG + Intergenic
1172111526 20:32548158-32548180 CAAGTTGCCCAAAGACAGGTGGG + Intronic
1173708752 20:45136030-45136052 GTACTGGCTCAGAGACAGCTAGG + Intergenic
1173721105 20:45258961-45258983 GGAGTTGCACAGAGATGGCCTGG + Intergenic
1175340608 20:58227040-58227062 GAAGTTGCATAGAGATATATGGG + Intronic
1175714167 20:61244572-61244594 TACGTTTCACAGAGGCAGCTGGG - Intergenic
1175876451 20:62232460-62232482 GCAGTTGCACACAGCCGGCTGGG - Intronic
1176843188 21:13856700-13856722 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176845876 21:13876046-13876068 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176848611 21:13895601-13895623 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176849543 21:13902233-13902255 AAAGATGCACAGGTACAGCTTGG - Intergenic
1178837151 21:36108350-36108372 GATGTAGCAGAGAGAGAGCTTGG - Intergenic
1180155361 21:45974782-45974804 GAAGTGGCACAGGGACAGAGAGG - Intergenic
1181050222 22:20234826-20234848 GGAGGGGCACAGAGACAGCCTGG - Intergenic
1184348564 22:43927959-43927981 GAAGATGCATAGAGGAAGCTCGG - Intronic
1184779485 22:46639852-46639874 TAGGTTGCATAGAGCCAGCTTGG + Intronic
949503291 3:4702835-4702857 GCAGTTGCACAAAGACAGGCTGG - Exonic
951278997 3:20724207-20724229 GAAGTTACACAGAGTCACCCAGG - Intergenic
952137297 3:30437586-30437608 TAAGTTTCACAGGGGCAGCTGGG - Intergenic
956136098 3:66100631-66100653 GAAGTTAGACACAGCCAGCTTGG + Intergenic
957955719 3:87184452-87184474 GAAGTTGCAGGAAGAAAGCTGGG - Intergenic
959274052 3:104254763-104254785 GGAGCTGCACAGAAACAGCTAGG - Intergenic
960022203 3:112967366-112967388 GAAGATGAACAGAAACAGCGAGG - Intronic
961863259 3:129934822-129934844 GAAGGTTCTCATAGACAGCTTGG + Intergenic
963506873 3:146197186-146197208 GAAGTGGCACAGAGATAAGTTGG + Intronic
966739139 3:183215785-183215807 GAAGATGCCAAGGGACAGCTTGG + Intronic
966843119 3:184105586-184105608 GAACCTGCAAAGAGACAGTTAGG - Intronic
967995480 3:195163213-195163235 AAAGTTGCACTGTGACAGTTTGG - Intronic
971707210 4:30060539-30060561 GAAAATGCACAGCGACAGCAGGG + Intergenic
972190361 4:36584067-36584089 TAAGATGCACAGAGACAGCGTGG + Intergenic
973367569 4:49219979-49220001 AAAGATGCACAGGTACAGCTTGG - Intergenic
973393484 4:49575453-49575475 AAAGATGCACAGGTACAGCTTGG + Intergenic
974547262 4:63328499-63328521 GAATCTGCACAGAGACATTTTGG - Intergenic
976419179 4:84818890-84818912 GAAGTTGCACAGGAAGAGATTGG - Intronic
976614826 4:87065805-87065827 GAGGTTGCACAGAGAAAGGGGGG - Intronic
977069988 4:92373419-92373441 GAAGTTGGGCTGACACAGCTGGG - Intronic
977640493 4:99353158-99353180 AAAGTGGAACAGAGAGAGCTAGG + Intergenic
981389078 4:144166847-144166869 GAAAGGGCACAGAGAAAGCTAGG - Intergenic
981718253 4:147773462-147773484 ACAGCTGCCCAGAGACAGCTTGG + Intronic
982202732 4:152975372-152975394 GAAGTCACTCAGAGTCAGCTGGG - Exonic
982918969 4:161250177-161250199 GCAGCTGCCCAGTGACAGCTGGG - Intergenic
983615408 4:169698877-169698899 GAAGATGCAAATAGACAGCCAGG - Intronic
984685019 4:182657707-182657729 GCAGTGGCACAGTCACAGCTTGG + Intronic
1202766038 4_GL000008v2_random:149274-149296 AAAGATGCACAGGTACAGCTTGG - Intergenic
986079188 5:4371809-4371831 TAAATTGTACAGAGAGAGCTGGG - Intergenic
986448271 5:7842175-7842197 GAAGTTGCACACAAATAACTGGG + Intronic
996816508 5:127579620-127579642 GAAGTTGCAGTGAGTGAGCTAGG + Intergenic
999065916 5:148685320-148685342 GTAGTGGTACAGAGTCAGCTAGG - Intergenic
1003105601 6:3212820-3212842 GAAACTTCACAGAGAGAGCTTGG + Intergenic
1003338438 6:5196906-5196928 GAAGTTCCACTGTGACAACTCGG + Intronic
1004286841 6:14329183-14329205 GAAGATGCAAGGAGACAGCCTGG - Intergenic
1007749140 6:44061329-44061351 GAAGTTCCCCAGAGAAAGTTGGG + Intergenic
1009985912 6:70780768-70780790 GAAGAGACACAGAGACAGCATGG - Intronic
1010490551 6:76471333-76471355 AAAGTTTCACAGTGAGAGCTGGG - Intergenic
1010499109 6:76572919-76572941 GGTGTTGTACAGAGACAGCCAGG - Intergenic
1010812825 6:80319061-80319083 AAAGTTGTCCAGAGGCAGCTAGG + Intronic
1013579379 6:111518081-111518103 CAAGTTGCAAGGATACAGCTCGG - Intergenic
1014498162 6:122153648-122153670 GAAGTTACACAAAGACTGCTGGG - Intergenic
1016662122 6:146594099-146594121 GAAGTTGCACAGACAGAGTATGG - Intergenic
1018487040 6:164251291-164251313 GGCTTTACACAGAGACAGCTCGG - Intergenic
1018712989 6:166510316-166510338 GAAGATGGAGAGAGACATCTTGG - Exonic
1019511390 7:1419368-1419390 GAAGTGGTGCAGAGACAGCGAGG - Intergenic
1021243561 7:18234718-18234740 GTAGGTTCACAGAGACAGCTGGG + Intronic
1023343896 7:39251728-39251750 GATGTTGCACAAAGACACCGGGG + Intronic
1023515345 7:40996236-40996258 GAGGCTACACAGTGACAGCTGGG - Intergenic
1024270980 7:47641265-47641287 GAAGCTGCTGAGAGACAGCAGGG - Intergenic
1024403646 7:48952484-48952506 GAAGTTTCATAAAAACAGCTTGG + Intergenic
1025535715 7:61945730-61945752 GTATTTGCACAGGGACAGTTAGG + Intergenic
1028783943 7:94770744-94770766 GAAGTTCAAAAGAGGCAGCTTGG - Intergenic
1029308881 7:99642917-99642939 CAAGTTGAACAGAGACAGTATGG + Intergenic
1029896975 7:103993477-103993499 GAAATTGCACTGAGAAAGGTGGG + Intergenic
1031404697 7:121370390-121370412 GAAGAGGCACATAAACAGCTAGG + Intronic
1031859596 7:126962970-126962992 AAAGTTGGACAGAGACATATAGG - Intronic
1032057603 7:128696312-128696334 GAAGTTCCACAGAAGCAGCCAGG - Intergenic
1034819444 7:154203244-154203266 GAAGTTGCGCAAATACAGGTGGG + Intronic
1035214557 7:157355530-157355552 GAAGTTGGACAAGGAGAGCTGGG + Intronic
1039826941 8:41182778-41182800 GAGGTTGCACAGATACAGACTGG - Intergenic
1040116219 8:43623095-43623117 GAATCTGCAAAGAGACAGTTTGG + Intergenic
1040118524 8:43653360-43653382 GAATTTGCATAGGGACATCTTGG + Intergenic
1040343571 8:46461565-46461587 GAATTTGCAAAGAGACATTTTGG - Intergenic
1040721647 8:50331183-50331205 GAAATAGCACACAGACAGGTGGG + Intronic
1041769914 8:61461829-61461851 GAAGGTTCTCATAGACAGCTGGG - Intronic
1043533650 8:81176582-81176604 AAAGGGGCACAGATACAGCTGGG - Intergenic
1044065664 8:87696990-87697012 GAAGTTGCAAATACACAGATGGG - Intergenic
1045393293 8:101736144-101736166 GAAGAGGAAAAGAGACAGCTCGG - Intronic
1046688375 8:117253595-117253617 AAAGTTCCTCAGAGACAGTTAGG + Intergenic
1048378165 8:133840780-133840802 AAACCTGCACAGAGACAGCCAGG - Intergenic
1048866891 8:138768028-138768050 GAAGTACCACAGGGACACCTGGG - Intronic
1050640601 9:7663288-7663310 GATGCTGCACAGATACAGCCTGG - Intergenic
1052877763 9:33580236-33580258 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052878649 9:33586423-33586445 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052879080 9:33589508-33589530 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052879514 9:33592624-33592646 AAAGATGCACAGGCACAGCTTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053496464 9:38551608-38551630 AAAGATGCACAGGCACAGCTTGG - Intronic
1053496896 9:38554711-38554733 AAAGATGCACAGGTACAGCTTGG - Intronic
1053497328 9:38557786-38557808 AAAGATGCACAGGCACAGCTTGG - Intronic
1053498222 9:38563969-38563991 AAAGATGCACAGGTACAGCTTGG - Intronic
1053664346 9:40307136-40307158 AAAGATGCACAGGTACAGCTTGG + Intronic
1053664870 9:40310391-40310413 AAAGATGCACAGGTACAGCTTGG + Intronic
1053666183 9:40319516-40319538 AAAGATGCACAGGTACAGCTTGG + Intronic
1053913418 9:42927604-42927626 AAAGATGCACAGGTACAGCTTGG + Intergenic
1053913914 9:42930833-42930855 AAAGATGCACAGGTACAGCTTGG + Intergenic
1053915327 9:42941466-42941488 AAAGATGCACAGGTACAGCTCGG + Intergenic
1053915767 9:42944563-42944585 AAAGATGCACAGTTACAGCTTGG + Intergenic
1054377336 9:64459544-64459566 AAAGATGCACAGGTACAGCTTGG + Intergenic
1054518426 9:66056767-66056789 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054519744 9:66065893-66065915 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054520268 9:66069149-66069171 AAAGATGCACAGGTACAGCTTGG - Intergenic
1055554238 9:77459488-77459510 GAAGTTGCAAAGAGACATCCTGG - Intronic
1056099358 9:83286111-83286133 CAAGTTTCTCAAAGACAGCTGGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056721910 9:89079631-89079653 AAAGTAGCACAGAAGCAGCTGGG - Intronic
1057161394 9:92890846-92890868 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057554352 9:96075765-96075787 CAAGTTTCACAGAAGCAGCTGGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057676805 9:97142268-97142290 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057677244 9:97145365-97145387 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057677687 9:97148453-97148475 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057699200 9:97350465-97350487 GAAGCTGCGCAGGGACACCTGGG - Exonic
1058998108 9:110319663-110319685 GAAGTTGAACAGAGAGAAGTTGG + Intronic
1059852762 9:118362791-118362813 GAAGTTGCACACAGGCAATTGGG + Intergenic
1061587190 9:131576739-131576761 GTAGTTGCACACATGCAGCTGGG + Intergenic
1061628110 9:131854117-131854139 GAAGTTGCAAAGAAACATATAGG - Intergenic
1203546787 Un_KI270743v1:134163-134185 AAAGATGCACAGGTACAGCTTGG - Intergenic
1185732627 X:2473650-2473672 AAAGGTGCACAGAGGCAGCCAGG + Intronic
1185733225 X:2477872-2477894 AAAGGTGCACAGAGGCAGCCAGG + Intronic
1187109803 X:16285329-16285351 AAAAATCCACAGAGACAGCTCGG + Intergenic
1187458986 X:19468262-19468284 GAAATGGGAAAGAGACAGCTAGG + Intronic
1190188772 X:48258106-48258128 GCAATGCCACAGAGACAGCTGGG - Intronic
1190216195 X:48481098-48481120 GAAGATGCACAGAGCCAGATGGG + Intronic
1190775796 X:53551393-53551415 GAAGTTCTACAGAACCAGCTAGG - Exonic
1192565323 X:72158590-72158612 GAAGTTGCACACTGCCAGGTGGG + Intergenic
1193239971 X:79156758-79156780 GAAGATGCTCAGAGATGGCTGGG - Intergenic
1198091547 X:133335985-133336007 GAAGTTGCACAGAGACAGCTGGG - Intronic
1199862168 X:151810905-151810927 GAAGTTAAACAGATACATCTCGG + Intergenic
1201888928 Y:18920288-18920310 GAAGTTGCAGTGAGCCAGCATGG + Intergenic