ID: 1198093525

View in Genome Browser
Species Human (GRCh38)
Location X:133355603-133355625
Sequence TGCTGCTTACTGCTACTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198093525_1198093526 -7 Left 1198093525 X:133355603-133355625 CCAGTAAGTAGCAGTAAGCAGCA 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1198093526 X:133355619-133355641 AGCAGCAACTTAGAACAAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 176
1198093525_1198093528 12 Left 1198093525 X:133355603-133355625 CCAGTAAGTAGCAGTAAGCAGCA 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1198093528 X:133355638-133355660 AAGGGTCAATGAAAATGTTTTGG 0: 1
1: 1
2: 2
3: 33
4: 344
1198093525_1198093527 -6 Left 1198093525 X:133355603-133355625 CCAGTAAGTAGCAGTAAGCAGCA 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1198093527 X:133355620-133355642 GCAGCAACTTAGAACAAGAAGGG 0: 1
1: 0
2: 0
3: 16
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198093525 Original CRISPR TGCTGCTTACTGCTACTTAC TGG (reversed) Intronic
902154412 1:14472582-14472604 TTCTGTTTTCTGCTACTTCCAGG - Intergenic
907695546 1:56724127-56724149 AGCTGCTTACTTATTCTTACTGG - Intronic
912309534 1:108606291-108606313 TGTTGCTTATTGCTATTTATAGG + Intronic
913013237 1:114706124-114706146 TGCTTCTTACTGCTAATTCTGGG - Exonic
922669489 1:227498089-227498111 GGCTGGGTACTGCTGCTTACGGG - Intergenic
922670104 1:227503213-227503235 GGCTGGGTACTGCTGCTTACGGG + Intergenic
1063688184 10:8258400-8258422 TGCTGCATAGTGTGACTTACAGG + Intergenic
1064374437 10:14782912-14782934 TGATGCTTCCTGTTACTTTCAGG - Intergenic
1065310496 10:24411512-24411534 TGATACTAACTGCTACTTACAGG + Intronic
1065471260 10:26083949-26083971 TGCAGAATACTGCTACTTAATGG + Intronic
1067536746 10:47116241-47116263 TGCTTCTTACTGCCACTCACAGG - Intergenic
1068486872 10:57670102-57670124 TCTTGCTCACTGATACTTACTGG - Intergenic
1074033852 10:109717962-109717984 TGCTCCTTCCTGCTGCTTATGGG - Intergenic
1076007510 10:126959634-126959656 TGCTGCTTACAGCTCCTTGAGGG + Intronic
1080939540 11:36900019-36900041 TGCTCCTGAGTGCTACTGACAGG - Intergenic
1082877363 11:58001851-58001873 TGTCTCTTACTGCTTCTTACTGG + Intergenic
1085603126 11:77873174-77873196 TGCAGCTCACTGCCACTCACTGG + Intronic
1087322067 11:96675194-96675216 TTTTGCTTTCTGCCACTTACAGG - Intergenic
1087789426 11:102391284-102391306 TGCTGCTGACAGCTAGATACTGG - Intergenic
1094261474 12:28505292-28505314 TTCTTCTTATTGCTACCTACCGG + Intronic
1095580457 12:43791385-43791407 TGTTTCTGACTGCCACTTACTGG - Intergenic
1097380141 12:58885166-58885188 TGCTTCTGACAGCTACTAACTGG + Intronic
1098633860 12:72757192-72757214 TGCTGCTGACTGCTGCTGCCAGG + Intergenic
1099590594 12:84583499-84583521 TGCTTCCTACTGCTTCGTACTGG + Intergenic
1102157034 12:110738752-110738774 TGCTGCCTCCTGCTACTGACAGG + Intronic
1104205118 12:126631645-126631667 CTCTGCTTTCTGCTACTTGCTGG - Intergenic
1107855303 13:44609416-44609438 TTCTTCTTACTGCTACCTAGCGG + Intergenic
1108111531 13:47079092-47079114 TTCTGCCAACTGCTAGTTACTGG - Intergenic
1112316887 13:98370863-98370885 TGCTGCTTTCTGCCAATTCCTGG - Intronic
1121415327 14:93775318-93775340 TGCTGCTCACTGCTGGTTCCCGG + Intronic
1122851452 14:104534690-104534712 GGCTGCTTCCTGCAACTTATTGG - Intronic
1127992994 15:64134430-64134452 TGCTGCTTCATGCTACTCCCAGG - Intronic
1130056437 15:80530355-80530377 TACTGCTTGCTGGGACTTACTGG + Intronic
1133578554 16:7119073-7119095 TGTTGCTTACTTTTACTGACTGG - Intronic
1134847469 16:17452045-17452067 TGGTGCCTCCTGCTACTGACAGG + Intronic
1135073763 16:19375456-19375478 TGCTACTTACTGCACCTTCCTGG - Intergenic
1135783279 16:25325053-25325075 TCTTGCTTGCAGCTACTTACAGG + Intergenic
1144168016 17:12631647-12631669 TGCTCCTTTCTGCTTCTTTCTGG - Intergenic
1151017528 17:70574094-70574116 TGCTGTTTACTGCTCTTTCCAGG - Intergenic
1153983740 18:10334671-10334693 TGCTGCTAACTGCTAGCTCCTGG + Intergenic
1158269189 18:55694451-55694473 TACTGCTTACTTCTGCTTCCTGG + Intergenic
1165002868 19:32779344-32779366 AACCGCTTACTGGTACTTACAGG - Intronic
931825963 2:66001326-66001348 TGCTGTTTACTGCTAACTATAGG + Intergenic
932747641 2:74347258-74347280 TTCTGATTTCTGCTCCTTACTGG + Intronic
933303908 2:80573816-80573838 TGCTGGTTGCTGCTGGTTACTGG - Intronic
933689845 2:85171481-85171503 TGGTGTGTACTGCTACTCACAGG + Intronic
935550230 2:104445075-104445097 TGCTGATTCATGCTACTTACTGG - Intergenic
946993757 2:225366955-225366977 TGCTGCTCTGTGCTACTTTCTGG + Intergenic
948310541 2:236982359-236982381 TTCTGCTGACTGCTGCCTACTGG - Intergenic
948349838 2:237330370-237330392 TGCTGCTCACTGCCATTTACAGG + Intronic
949001191 2:241614993-241615015 TTCTGCTTTCTGGAACTTACAGG - Intronic
1170704638 20:18734251-18734273 TGTTTCTTCCTGCTACTTACAGG - Intronic
1170801044 20:19590630-19590652 TTCTGCTCTCTGCTACTCACAGG - Intronic
1172331089 20:34076698-34076720 TGCAGCTCACTGCTCTTTACTGG - Exonic
1173151634 20:40571220-40571242 TTCTGCTTACTGGTAATTATTGG + Intergenic
1177707523 21:24726692-24726714 CTCTGCTTACTCCTCCTTACTGG - Intergenic
1177822041 21:26041607-26041629 TGCTGCTTACTGAGACCTAATGG - Intronic
1178250853 21:31001862-31001884 TGTTGCTCACTGCTACTTCTTGG + Intergenic
956807902 3:72835375-72835397 TGCTGCTCCCTGTTACTCACTGG + Intronic
962986236 3:140538493-140538515 TACTGCTTACTGCAACTCTCAGG - Intronic
966093560 3:176170859-176170881 TGCTGAGTTGTGCTACTTACTGG + Intergenic
966652929 3:182321698-182321720 GTCTGCTTACTGCTGCTTCCTGG + Intergenic
973292633 4:48484585-48484607 AGCTGCTGACTGCTACTTGTTGG - Intronic
977522796 4:98106608-98106630 TGCTACCTACTGCTACCTATTGG + Intronic
979340989 4:119523887-119523909 TTCTGCTTCTTGCTAGTTACAGG - Intronic
982818817 4:159920508-159920530 TTCTGCTTCTTGCTACTTTCAGG - Intergenic
988224725 5:28398523-28398545 GGTTTGTTACTGCTACTTACTGG - Intergenic
988917448 5:35909003-35909025 TGCTGCTGACTGTTACTCAAGGG + Intronic
990062211 5:51665659-51665681 TTCTGCTTACTGATACATACAGG - Intergenic
991470912 5:66968112-66968134 TCCAGCCTACAGCTACTTACTGG - Intronic
993761838 5:91805038-91805060 TGCTGCTTTCTTGTACTTATTGG - Intergenic
996191325 5:120546449-120546471 TGCTGGTTCCTGCTAATAACAGG - Intronic
996562828 5:124849213-124849235 TTCAGCTTCCTGTTACTTACAGG + Intergenic
997631683 5:135373586-135373608 TGCTACTCACTGTCACTTACAGG - Intronic
998286701 5:140869732-140869754 TGCTGCTAACAGCTACAGACGGG + Exonic
999440943 5:151600197-151600219 TTCTGCTTACTGACTCTTACTGG + Intergenic
1000746048 5:165035338-165035360 GGCTGCTCACTGCAACATACTGG + Intergenic
1001884002 5:175271938-175271960 TGTCGCTTTCTTCTACTTACAGG + Intergenic
1003465039 6:6370963-6370985 TGCTGTTTGATTCTACTTACAGG + Intergenic
1007628988 6:43262375-43262397 GGCTGCTTCCTGCTGCTTCCAGG - Intronic
1013300335 6:108799188-108799210 TGCTGATTACTGTTAATGACGGG + Intergenic
1013927051 6:115486022-115486044 TTCTTCTTGCTTCTACTTACTGG + Intergenic
1016698155 6:147022234-147022256 TGTTTCTTGCTGCTACTTCCCGG + Intergenic
1018385232 6:163297244-163297266 TGGTGCTTACTGGTGCTTAAAGG + Intronic
1021661424 7:22922474-22922496 TGCAGCTTACTGCCACTGCCTGG + Intergenic
1021988416 7:26119455-26119477 TGCTGCTCACTGCTGCCAACTGG - Intergenic
1033192323 7:139292853-139292875 TGCTGCAGACTGCTGCTTTCAGG - Intronic
1035486728 7:159231815-159231837 TGTTGCCTTCTGCTACTTTCAGG + Intergenic
1043453172 8:80389002-80389024 AGCTGTTTGCTGCCACTTACTGG + Intergenic
1044729640 8:95219589-95219611 AGCTTCTTACTGCTGTTTACAGG + Intergenic
1047897984 8:129387921-129387943 TGCTGATTCCTGCTACGTACTGG + Intergenic
1049966903 9:788033-788055 TCCTGCTCTCTGCTACATACTGG - Intergenic
1050251914 9:3753521-3753543 TCCTGCTTGCTCCTTCTTACCGG + Intergenic
1050364926 9:4864979-4865001 TGCTGCTTCCTGCTACATCTGGG + Intronic
1050540315 9:6664202-6664224 AGACCCTTACTGCTACTTACAGG + Intergenic
1051198132 9:14586314-14586336 TGCTGCTTGCTGCTACAAAGAGG + Intergenic
1052550461 9:29940962-29940984 TGCTGGTTATTGTTACTTGCAGG - Intergenic
1056821387 9:89844604-89844626 TGCTACTTCCTGCTCCATACAGG + Intergenic
1185695918 X:2194475-2194497 TGCTGTTTACTGCTCCGTCCTGG + Intergenic
1189713257 X:43837761-43837783 TGCTGCTTACTTCCACCCACAGG + Intronic
1194933599 X:99919165-99919187 TTCTGCTTGTTGCTACATACTGG + Intergenic
1198093525 X:133355603-133355625 TGCTGCTTACTGCTACTTACTGG - Intronic
1199429000 X:147737189-147737211 TTCTTCTTACTTCCACTTACTGG - Intergenic
1201759543 Y:17521967-17521989 GGCTGGGTACTGCTACTTATGGG - Intergenic
1201842011 Y:18384023-18384045 GGCTGGGTACTGCTACTTATGGG + Intergenic