ID: 1198096702

View in Genome Browser
Species Human (GRCh38)
Location X:133387045-133387067
Sequence AGCCAGCTTGCTAGCGGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 53}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198096702_1198096707 21 Left 1198096702 X:133387045-133387067 CCTACACCGCTAGCAAGCTGGCT 0: 1
1: 0
2: 1
3: 6
4: 53
Right 1198096707 X:133387089-133387111 GGATTCAACTGTACCCCGACAGG 0: 1
1: 0
2: 0
3: 0
4: 32
1198096702_1198096705 0 Left 1198096702 X:133387045-133387067 CCTACACCGCTAGCAAGCTGGCT 0: 1
1: 0
2: 1
3: 6
4: 53
Right 1198096705 X:133387068-133387090 GTTTCAACCTGTGCTGACATGGG 0: 1
1: 0
2: 0
3: 9
4: 453
1198096702_1198096704 -1 Left 1198096702 X:133387045-133387067 CCTACACCGCTAGCAAGCTGGCT 0: 1
1: 0
2: 1
3: 6
4: 53
Right 1198096704 X:133387067-133387089 TGTTTCAACCTGTGCTGACATGG 0: 1
1: 0
2: 1
3: 36
4: 526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198096702 Original CRISPR AGCCAGCTTGCTAGCGGTGT AGG (reversed) Intronic
904622743 1:31785068-31785090 AGCCAGCGGGTTAGCGGTGATGG + Intergenic
904920530 1:34004408-34004430 AGCCAGCTTGCTAGAGCATTTGG + Intronic
905884137 1:41482601-41482623 AGCCAGCAAGGTAGTGGTGTGGG + Intronic
906601816 1:47137200-47137222 AGGCAGTATGCTAGGGGTGTGGG - Intergenic
912517506 1:110225559-110225581 ACCTGGCTTGCTAGCGGTGAGGG - Intronic
919674559 1:200368268-200368290 TGCCAGCTTGCTAGCTGTGTGGG - Intergenic
921798718 1:219377835-219377857 ACCCAGCTTCCTAAAGGTGTAGG + Intergenic
1064340544 10:14481541-14481563 AGCCATCTTGCTAGCCTTGCGGG - Intergenic
1067525037 10:47033401-47033423 AGACAGCTTGCTGGCTGGGTGGG + Intergenic
1070759931 10:79017746-79017768 AGCCAGCTTCCTAGGAGTATGGG + Intergenic
1075473789 10:122715549-122715571 ACACAGCTTGCTAGAGGTGCAGG - Intergenic
1075778020 10:125000509-125000531 AACCAGCTTGCTAGAGGCGGCGG + Intronic
1080036954 11:27720456-27720478 AGTTGGCTTCCTAGCGGTGTAGG - Intronic
1081163809 11:39785010-39785032 AGCCAGCTGGGGAGCGGTGAGGG + Intergenic
1082194265 11:49283147-49283169 ATCCAACTTGATAGTGGTGTGGG - Intergenic
1086296036 11:85369259-85369281 AGCCAGCCAGCTAGCTGTGTGGG - Intronic
1099156836 12:79187783-79187805 AGCGAGATTGCTAGTGGTCTTGG - Intronic
1102561629 12:113766503-113766525 AGCCAACTTGCTACCGGGGCCGG - Intergenic
1109887540 13:68561615-68561637 AGTCAGCTTTCAAGCAGTGTGGG - Intergenic
1123631680 15:22265346-22265368 ACCCAGCTTGCCAGTGGGGTGGG + Intergenic
1127880841 15:63157446-63157468 TTGCAGCTTGCTAGCTGTGTGGG - Exonic
1136065222 16:27754101-27754123 AGCCAGCCAGCTAGCTGTGTGGG + Intronic
1138721608 16:59088780-59088802 GTGCAGCTCGCTAGCGGTGTTGG + Intergenic
1139126556 16:64085225-64085247 ATCAAGTTTGCTAGCAGTGTTGG + Intergenic
1140531199 16:75668007-75668029 GGCCAGCTTGCTAGCTGTGCAGG - Intronic
1140536802 16:75717158-75717180 GGCCAGCTTGCTAGCTGTGCAGG - Intronic
1142088425 16:88197128-88197150 AGCCAGCTTCCTAGGTGTGATGG - Intergenic
1154050638 18:10953582-10953604 AGCCAGTTTGCTATTGGTGAAGG - Intronic
1155338858 18:24793815-24793837 AGTCAGCCTTCTAGAGGTGTTGG + Intergenic
1162966859 19:14160253-14160275 GGCCAGCTCGCTGGCGATGTTGG + Exonic
1163198255 19:15741622-15741644 AGCCAGCATGCGAGGGGTGATGG - Exonic
1163224601 19:15949237-15949259 AGCCAGCATGCGAGGGGTGATGG - Exonic
1165146223 19:33732440-33732462 AGCCAGTTGGCCAGCGGTGCAGG - Intronic
1165146229 19:33732491-33732513 AGCCAGCTGGCCAGCAGTGTAGG + Intronic
1165417694 19:35704827-35704849 AGCCAGCTTGCTCTCTGAGTTGG + Intronic
1165426002 19:35745755-35745777 AGCCAGCTTACTAGTGGGGGTGG + Intronic
1167744775 19:51344157-51344179 AGCCAGCTTGCTGGCTATGTGGG + Intergenic
930144017 2:47982809-47982831 AGCCAGCTTACTACCGCAGTAGG + Intergenic
933184155 2:79260128-79260150 GGCCAGCTTGCCATGGGTGTTGG + Intronic
937758204 2:125566452-125566474 AGCCAAGTTGCTAGCAGTGAGGG - Intergenic
1182303329 22:29351067-29351089 TGCCAGCTTGCTTGTGGTCTGGG - Intronic
1182731832 22:32502268-32502290 AGCCAGCTTGCTTGCCCTCTAGG + Intergenic
957574084 3:81986603-81986625 AGCCAGCCAACTAGCTGTGTGGG - Intergenic
959431166 3:106256613-106256635 AACCAGCCTGCTGGCTGTGTGGG - Intergenic
974440490 4:61909582-61909604 AGCCAGCTCTCTAGCAATGTTGG - Exonic
974489383 4:62544994-62545016 AGCCAGATTGCAAGCAGAGTTGG - Intergenic
978195454 4:105966811-105966833 AGCCAGATCGCCAGGGGTGTTGG + Intronic
985885189 5:2672139-2672161 AGCCGGCTTGCCAGCCGTGATGG - Intergenic
985949339 5:3211299-3211321 TGGCAGCTTGTTAGGGGTGTCGG - Intergenic
997262991 5:132477988-132478010 AGCCATGTTGCCAGGGGTGTTGG + Intergenic
1004175326 6:13335076-13335098 AGCCAGCCTGGCAGCTGTGTTGG + Intergenic
1004932992 6:20479673-20479695 AGCCAGGATTCTAGCGTTGTAGG - Intronic
1005813754 6:29534141-29534163 AGCCAGGTGACTAGCGGGGTCGG + Intergenic
1011621773 6:89250262-89250284 TGCCAGCTTCCTAGCGGAGGTGG + Intergenic
1024772839 7:52744759-52744781 AGCCAGCTTGCCATCTTTGTGGG - Intergenic
1048869549 8:138785703-138785725 TGCCAGTTTTCTAGCGTTGTTGG + Intronic
1048878453 8:138854762-138854784 AGACAGCTTGATAGAGGTGGTGG + Intronic
1053433758 9:38061404-38061426 AGCCAGCATGCGAGCTCTGTTGG + Intronic
1190484816 X:50913765-50913787 AGACAGCCTGCTAGAGGTTTGGG + Intronic
1198096702 X:133387045-133387067 AGCCAGCTTGCTAGCGGTGTAGG - Intronic
1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG + Intronic