ID: 1198109663

View in Genome Browser
Species Human (GRCh38)
Location X:133491873-133491895
Sequence TTAGTTCAGCTGTTCACTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198109662_1198109663 -1 Left 1198109662 X:133491851-133491873 CCTGGAGAGAGAATGGCTTATCT No data
Right 1198109663 X:133491873-133491895 TTAGTTCAGCTGTTCACTTTTGG No data
1198109661_1198109663 0 Left 1198109661 X:133491850-133491872 CCCTGGAGAGAGAATGGCTTATC No data
Right 1198109663 X:133491873-133491895 TTAGTTCAGCTGTTCACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198109663 Original CRISPR TTAGTTCAGCTGTTCACTTT TGG Intergenic
No off target data available for this crispr