ID: 1198112313

View in Genome Browser
Species Human (GRCh38)
Location X:133512679-133512701
Sequence CAATATCAGCAGGAATTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198112303_1198112313 14 Left 1198112303 X:133512642-133512664 CCTGGACACAGCGCTGGCCTAAG No data
Right 1198112313 X:133512679-133512701 CAATATCAGCAGGAATTGGACGG No data
1198112300_1198112313 28 Left 1198112300 X:133512628-133512650 CCAATCCATGTCGTCCTGGACAC No data
Right 1198112313 X:133512679-133512701 CAATATCAGCAGGAATTGGACGG No data
1198112305_1198112313 -3 Left 1198112305 X:133512659-133512681 CCTAAGGTAGCCCCACCTGCCAA No data
Right 1198112313 X:133512679-133512701 CAATATCAGCAGGAATTGGACGG No data
1198112301_1198112313 23 Left 1198112301 X:133512633-133512655 CCATGTCGTCCTGGACACAGCGC No data
Right 1198112313 X:133512679-133512701 CAATATCAGCAGGAATTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198112313 Original CRISPR CAATATCAGCAGGAATTGGA CGG Intergenic
No off target data available for this crispr