ID: 1198112433

View in Genome Browser
Species Human (GRCh38)
Location X:133513688-133513710
Sequence CATGATTGCTTCTAATCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198112421_1198112433 30 Left 1198112421 X:133513635-133513657 CCCCTGTCTGATCTAGGGCCTGT No data
Right 1198112433 X:133513688-133513710 CATGATTGCTTCTAATCCAAGGG No data
1198112424_1198112433 12 Left 1198112424 X:133513653-133513675 CCTGTGCTGCCTTAAATCAAGTA No data
Right 1198112433 X:133513688-133513710 CATGATTGCTTCTAATCCAAGGG No data
1198112422_1198112433 29 Left 1198112422 X:133513636-133513658 CCCTGTCTGATCTAGGGCCTGTG No data
Right 1198112433 X:133513688-133513710 CATGATTGCTTCTAATCCAAGGG No data
1198112426_1198112433 3 Left 1198112426 X:133513662-133513684 CCTTAAATCAAGTAGTCCCAGGA No data
Right 1198112433 X:133513688-133513710 CATGATTGCTTCTAATCCAAGGG No data
1198112423_1198112433 28 Left 1198112423 X:133513637-133513659 CCTGTCTGATCTAGGGCCTGTGC No data
Right 1198112433 X:133513688-133513710 CATGATTGCTTCTAATCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198112433 Original CRISPR CATGATTGCTTCTAATCCAA GGG Intergenic
No off target data available for this crispr