ID: 1198113484

View in Genome Browser
Species Human (GRCh38)
Location X:133523114-133523136
Sequence TTCAAGAGGAAGAATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198113479_1198113484 29 Left 1198113479 X:133523062-133523084 CCAGAAGATTTTTGGATAAGAAA No data
Right 1198113484 X:133523114-133523136 TTCAAGAGGAAGAATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198113484 Original CRISPR TTCAAGAGGAAGAATGTGGA AGG Intergenic
No off target data available for this crispr