ID: 1198117629

View in Genome Browser
Species Human (GRCh38)
Location X:133559403-133559425
Sequence GCCAGGTGCCATAGTGGGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198117625_1198117629 -1 Left 1198117625 X:133559381-133559403 CCTGTTGTTTGCTAGACACTGTG 0: 1
1: 0
2: 3
3: 64
4: 459
Right 1198117629 X:133559403-133559425 GCCAGGTGCCATAGTGGGTACGG 0: 1
1: 0
2: 1
3: 11
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198117629 Original CRISPR GCCAGGTGCCATAGTGGGTA CGG Intronic
900988116 1:6085130-6085152 GCCAGTGGCCACAGTGGGTCTGG + Intronic
902459679 1:16564442-16564464 GCCAGGTGACATACTGGTAAGGG + Intronic
902622814 1:17660273-17660295 GGCAGATGGCATAATGGGTAAGG + Intronic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
904027942 1:27516414-27516436 GCTAGGTGCTGGAGTGGGTATGG + Intergenic
904744330 1:32702096-32702118 GCCAGGAGGGATAGTGGGGAGGG + Intronic
907029220 1:51153988-51154010 ACCAGGAGCTCTAGTGGGTATGG - Intergenic
908455719 1:64302961-64302983 GCTTGGTGCCATAGTGGGGATGG + Intergenic
909342095 1:74543658-74543680 GCCAGGTGGCATTTTGGGTTTGG - Intronic
913643331 1:120833325-120833347 GCCAGGTGACATACTGGTAATGG - Intronic
913643632 1:120835968-120835990 GCCAGGTGACATACTGGTAATGG - Intronic
913644097 1:120840083-120840105 GCCAGGTGACATACTGGTAAGGG - Intronic
914178090 1:145296774-145296796 GCCAGGTGACATACTGGTAAGGG + Intronic
914178635 1:145301536-145301558 GCCAGGTGACATACTGGTAAGGG + Intronic
914179932 1:145312644-145312666 GCCAGGTGACATACTGGTAAGGG + Intronic
914180478 1:145317416-145317438 GCCAGGTGACATACTGGTAAGGG + Intronic
914181021 1:145322178-145322200 GCCAGGTGACATACTGGTAAGGG + Intronic
914181564 1:145326926-145326948 GCCAGGTGACATACTGGTAAGGG + Intronic
914182109 1:145331693-145331715 GCCAGGTGACATACTGGTAAGGG + Intronic
914182654 1:145336449-145336471 GCCAGGTGACATACTGGTAAGGG + Intronic
914183199 1:145341199-145341221 GCCAGGTGACATACTGGTAAGGG + Intronic
914183744 1:145345957-145345979 GCCAGGTGACATACTGGTAAGGG + Intronic
914184287 1:145350729-145350751 GCCAGGTGACATACTGGTAAGGG + Intronic
914184831 1:145355491-145355513 GCCAGGTGACATACTGGTAAGGG + Intronic
914185376 1:145360238-145360260 GCCAGGTGACATACTGGTAAGGG + Intronic
914185921 1:145364992-145365014 GCCAGGTGACATACTGGTAAGGG + Intronic
914186468 1:145369752-145369774 GCCAGGTGACATACTGGTAAGGG + Intronic
914187012 1:145374500-145374522 GCCAGGTGACATACTGGTAAGGG + Intronic
914187555 1:145379252-145379274 GCCAGGTGACATACTGGTAAGGG + Intronic
914188100 1:145384006-145384028 GCCAGGTGACATACTGGTAAGGG + Intronic
914188643 1:145388756-145388778 GCCAGGTGACATACTGGTAAGGG + Intronic
914210514 1:145574456-145574478 GCCAGGTGACATACTGGTAAGGG + Intergenic
914269442 1:146066815-146066837 GCCAGGTGACATACTGGTAAGGG + Intronic
914269799 1:146069959-146069981 GCCAGGTGACATACTGGTAAGGG + Intronic
914270339 1:146074681-146074703 GCCAGGTGACATACTGGTAAGGG + Intronic
914270876 1:146079417-146079439 GCCAGGTGACATACTGGTAAGGG + Intronic
914271413 1:146084153-146084175 GCCAGGTGACATACTGGTAAGGG + Intronic
914271948 1:146088874-146088896 GCCAGGTGACATACTGGTAAGGG + Intronic
914272485 1:146093592-146093614 GCCAGGTGACATACTGGTAAGGG + Intronic
914273023 1:146098314-146098336 GCCAGGTGACATACTGGTAAGGG + Intronic
914273561 1:146103036-146103058 GCCAGGTGACATACTGGTAAGGG + Intronic
914274100 1:146107754-146107776 GCCAGGTGACATACTGGTAAGGG + Intronic
914274637 1:146112464-146112486 GCCAGGTGACATACTGGTAAGGG + Intronic
914275170 1:146117182-146117204 GCCAGGTGACATACTGGTAAGGG + Intronic
914275707 1:146121918-146121940 GCCAGGTGACATACTGGTAAGGG + Intronic
914367118 1:146989292-146989314 GCCAGGTGACATACTGGTAAGGG - Intronic
914367654 1:146994050-146994072 GCCAGGTGACATACTGGTAAGGG - Intronic
914485328 1:148104172-148104194 GCCAGGTGACATACTGGTAAGGG + Intronic
914532275 1:148533496-148533518 GCCAGGTGACATACTGGTAAGGG + Intronic
914532636 1:148536646-148536668 GCCAGGTGACATACTGGTAAGGG + Intronic
914533171 1:148541366-148541388 GCCAGGTGACATACTGGTAAGGG + Intronic
914533706 1:148546080-148546102 GCCAGGTGACATACTGGTAAGGG + Intronic
914534242 1:148550788-148550810 GCCAGGTGACATACTGGTAAGGG + Intronic
914534778 1:148555502-148555524 GCCAGGTGACATACTGGTAAGGG + Intronic
914535313 1:148560219-148560241 GCCAGGTGACATACTGGTAAGGG + Intronic
914535850 1:148564955-148564977 GCCAGGTGACATACTGGTAAGGG + Intronic
914536385 1:148569677-148569699 GCCAGGTGACATACTGGTAAGGG + Intronic
914536744 1:148572865-148572887 GCCAGGTGACATACTGGTAAGGG + Intronic
914585290 1:149056147-149056169 GCCAGGTGACATACTGGTAAGGG + Intronic
914629175 1:149492477-149492499 GCCAGGTGACATACTGGTAAGGG - Intergenic
914629708 1:149497240-149497262 GCCAGGTGACATACTGGTAAGGG - Intergenic
914630243 1:149501995-149502017 GCCAGGTGACATACTGGTAAGGG - Intergenic
914630777 1:149506756-149506778 GCCAGGTGACATACTGGTAAGGG - Intergenic
914631308 1:149511517-149511539 GCCAGGTGACATACTGGTAAGGG - Intergenic
914631839 1:149516273-149516295 GCCAGGTGACATACTGGTAAGGG - Intergenic
914632376 1:149521026-149521048 GCCAGGTGACATACTGGTAAGGG - Intergenic
914632911 1:149525783-149525805 GCCAGGTGACATACTGGTAAGGG - Intergenic
914633446 1:149530512-149530534 GCCAGGTGACATACTGGTAAGGG - Intergenic
914633982 1:149535263-149535285 GCCAGGTGACATACTGGTAAGGG - Intergenic
914634515 1:149540014-149540036 GCCAGGTGACATACTGGTAAGGG - Intergenic
914635050 1:149544751-149544773 GCCAGGTGACATACTGGTAAGGG - Intergenic
914635585 1:149549488-149549510 GCCAGGTGACATACTGGTAAGGG - Intergenic
914636120 1:149554225-149554247 GCCAGGTGACATACTGGTAAGGG - Intergenic
920342261 1:205282872-205282894 GCCGGGTGCATTAGTGGGTGTGG - Intergenic
920696299 1:208183587-208183609 GCCAGGTGCCAGAGAGGGAGAGG + Intronic
921341768 1:214140928-214140950 GCCTGGTGCCCTAGTGAGAAAGG - Intergenic
922791914 1:228315625-228315647 GCCCAGTGCCAAAGTGGGCAGGG + Intronic
923085718 1:230702270-230702292 CCCAGGTGCCACATGGGGTATGG + Intergenic
923208994 1:231786515-231786537 GCCAGGTGCTAAGGTGGTTATGG + Intronic
924086867 1:240461430-240461452 GCCAGGTGCCGTGCTGGGCATGG + Intronic
1066300910 10:34094653-34094675 ACCAGGTGCGCTAGTGGGTGTGG - Intergenic
1071676778 10:87662234-87662256 GCCAGGTGGTATACTGGGTGGGG + Intronic
1075390377 10:122087027-122087049 GCCAGGTGCCGGTGTGGGGAAGG + Exonic
1075452749 10:122563649-122563671 TCCAGCTGCCATTGTGGGAATGG - Intronic
1076291048 10:129345961-129345983 GCCAGGCACCATGGTGGGAAGGG + Intergenic
1077479700 11:2807822-2807844 GCCAGGAGGCATGGTGGGCAGGG - Intronic
1078337378 11:10474803-10474825 GCCAGGTGCAAGTGTGGGTGGGG + Intronic
1084939803 11:72606512-72606534 GCCAGGTTCCGTGGTGGGTGTGG + Intronic
1087619953 11:100529291-100529313 GTCAGCTGCCATAGTGGTGAAGG - Intergenic
1087718450 11:101635954-101635976 GCCAGGAGCTATACAGGGTAAGG + Intronic
1090927462 11:131261083-131261105 GCCAGGTGCCATTTTGGGGCTGG - Intergenic
1092215241 12:6677401-6677423 GTCACGTGCCCTAGTGGGTTTGG - Intronic
1094431033 12:30369261-30369283 GACAGGGGACATAGTGGGAATGG + Intergenic
1095108336 12:38261609-38261631 CCCTGCTGCCAAAGTGGGTAGGG - Intergenic
1095215702 12:39544730-39544752 GACAGGAGACATAGTGGGAATGG + Intergenic
1104096945 12:125566660-125566682 GCCAGATGCCACAGTTGATAGGG + Intronic
1104541471 12:129669975-129669997 GACAGGGGACATAGTGGGAATGG - Intronic
1119133731 14:72197516-72197538 GCCTGGGGCTACAGTGGGTAGGG + Intronic
1121096183 14:91219669-91219691 GCCAAGGGCCAGAGTGGGCAGGG - Intronic
1121607662 14:95253146-95253168 GTCAGGGGCCACAGTGGGCATGG - Intronic
1122264844 14:100541735-100541757 GCCAGGTGCCCCAGGGGCTATGG - Intronic
1122867111 14:104611428-104611450 CCCAGGTGCTGTATTGGGTAGGG - Intergenic
1128479885 15:68028059-68028081 GGCAGGCGCCATAGTGGTTTTGG + Intergenic
1133233748 16:4378374-4378396 GCCAGGTTCCAGAGTGGGAGGGG - Intronic
1135309822 16:21396712-21396734 GCAAGGTGCCATATTGGAAATGG - Intergenic
1136033115 16:27517866-27517888 GCCAGGTGGCCTAGTGTGGAAGG - Intronic
1136149402 16:28337034-28337056 GCAAGGTGCCATATTGGAAATGG - Intergenic
1136306567 16:29375836-29375858 GCAAGGTGCCATATTGGAAATGG - Intergenic
1141848430 16:86627112-86627134 GCCAGGGGCCAAAGGGAGTAGGG - Intergenic
1141998525 16:87649738-87649760 CCCAGGGGCCAAAGTGGGGAGGG - Intronic
1142033335 16:87849179-87849201 GCCAGGTGCCAGCGAGGGGAGGG + Intronic
1143348948 17:6272691-6272713 GCAAGTTGCCATGGGGGGTATGG + Intergenic
1143378493 17:6480938-6480960 GCCAGGGCCCACAGTGGGCAAGG + Intronic
1143637468 17:8174359-8174381 GGCAGGTGGCATGGGGGGTAGGG + Intronic
1143832561 17:9663997-9664019 GTCTGGTGCCACAGTGGGTGGGG - Intronic
1144178768 17:12732786-12732808 GCCAGGTGTCAGAGTGGAAAGGG + Intronic
1147366473 17:39962809-39962831 GGCAGGTGCCAGCGTGGGTGGGG - Intergenic
1148593542 17:48834696-48834718 GACAGGTTCTATAGTGGGAAAGG + Intronic
1148737816 17:49874634-49874656 GCCAGGGGCCATGGTGGGAAGGG - Intergenic
1149696614 17:58621326-58621348 GCCAGGTGTCCTGCTGGGTAAGG + Intronic
1151231208 17:72686445-72686467 GCCAAGAGCCATGCTGGGTAAGG - Intronic
1160955711 19:1690889-1690911 GCCAGGTCCCCTAGAGGGAAGGG - Intergenic
1161994669 19:7704745-7704767 TCTAGGTGGCATAGTGGCTAGGG + Intergenic
1163145632 19:15377872-15377894 GACAGATGCCATAGTGGGCGGGG - Intronic
1164885762 19:31777213-31777235 GCCAGGTGACTCAGTGGGCATGG + Intergenic
1166419845 19:42628108-42628130 GACAGGGGACATAGTGGGAATGG - Intronic
1166749635 19:45158787-45158809 GGCTGGTGCCGTGGTGGGTAAGG + Exonic
1168554264 19:57325027-57325049 GCCAGGTGGCATATTGATTAAGG + Intronic
1202675923 1_KI270711v1_random:6626-6648 GCCAGGTGACATACTGGTAAGGG + Intergenic
926640460 2:15230271-15230293 GCCAGGTGCATTATTGGGAAGGG + Intronic
930391890 2:50771946-50771968 GTCAAGTGCCATAGCAGGTAAGG + Intronic
932118394 2:69075456-69075478 GCCTGGTGCCATACTGGAGAAGG - Intronic
936171172 2:110176954-110176976 GCAAGGTGCCATAGAGAGAAGGG - Intronic
937858319 2:126688755-126688777 GTCAGGAGTCATAGTGGGTGAGG - Intronic
943663423 2:190583876-190583898 GCCAGGCGCCAAAGAGGGAATGG - Intergenic
944401498 2:199331916-199331938 GCCAGATGACATAGTGGCAAGGG - Intronic
947466717 2:230356748-230356770 GCTAGTTGCAATAGTAGGTAGGG - Intronic
948502444 2:238405358-238405380 GCCAGCTGCCAGAGGGGGCAGGG - Intergenic
1171369906 20:24655378-24655400 GAGAGGTGACAAAGTGGGTAGGG + Intronic
1173172771 20:40741033-40741055 CCAAGGTGACACAGTGGGTAGGG + Intergenic
1174121439 20:48268684-48268706 CCCAGGGTCCATGGTGGGTAGGG + Intergenic
1174289494 20:49497643-49497665 GCCTGGTGCCTTGGTAGGTATGG - Intergenic
1179427775 21:41295575-41295597 GCCAGGTGCCATAGGTGCTATGG + Intergenic
1179655487 21:42841987-42842009 GCCAGGTGCCATCCTGAGCAGGG + Intergenic
1181824608 22:25504929-25504951 CACAGGTGGCAGAGTGGGTAAGG - Intergenic
1181988218 22:26816528-26816550 AACAGGTGCCAGAGAGGGTAAGG - Intergenic
953613440 3:44468147-44468169 GACAGGGGACATAGTGGGAATGG - Intronic
954689624 3:52388724-52388746 CCCAGGTGCCACAGTGGGTAGGG + Intronic
956226000 3:66959078-66959100 GCCATGTAGCATAGTGGGTCAGG + Intergenic
956663538 3:71621341-71621363 ACCAGGGGCCATACTGAGTATGG + Intergenic
959013037 3:101100474-101100496 GCCTGGTCCCATAGAGGGTATGG + Intergenic
960261694 3:115575413-115575435 GTCAGGGGTCATGGTGGGTATGG + Intergenic
960788616 3:121401293-121401315 GCTAGTTGCAATAGTAGGTAGGG - Intronic
961271804 3:125695078-125695100 CCCAGGTGGCATTGTGGGTCTGG - Intergenic
963353000 3:144175823-144175845 GCACGGTGCCATAGCGGGTGCGG - Intergenic
963447179 3:145427544-145427566 GCGTGGAGCCACAGTGGGTATGG - Intergenic
964890734 3:161531699-161531721 GACTGGTGTCAAAGTGGGTAGGG - Intergenic
969095378 4:4728923-4728945 GCCAGGAGCCATGCTGGATATGG - Intergenic
972298030 4:37758816-37758838 GCCACTTGCAATAGGGGGTAAGG - Intergenic
977487593 4:97668173-97668195 GTCAGGTGAAAAAGTGGGTAAGG + Intronic
982380706 4:154744497-154744519 GGTAGATGCCATAGTGGGTCAGG - Exonic
992166189 5:74054311-74054333 GTCAGGGGCCATGGTGGCTATGG - Intergenic
992249393 5:74862309-74862331 CCCAGGTCCCATGGTGGGTTGGG - Intronic
995837384 5:116412120-116412142 ACTAGGTGCCATAGTGGGGAGGG - Intronic
998170491 5:139869709-139869731 CCCAGGTGCCCTGGTGGGAAAGG + Intronic
1000548029 5:162625820-162625842 TCCAGGTGCCATTGGGGGTGGGG - Intergenic
1002102060 5:176862574-176862596 GCCAGGGGCCAGACTGGGCAGGG - Intronic
1002276461 5:178107235-178107257 CCCAGGTGCGAGAGTGGGGAGGG + Intergenic
1003501874 6:6709952-6709974 TCCAGGAGCCACAGTGGGAATGG + Intergenic
1005299220 6:24454645-24454667 GCCAGGTGCCTTTGTGGCTGTGG - Intronic
1006592861 6:35170955-35170977 GCCAGCAGGCATAGGGGGTAGGG + Intergenic
1008594247 6:53025288-53025310 GGGAGTTGCCATAGTGGGTAGGG - Intronic
1014815792 6:125934067-125934089 CCCAGGTGCCAAACTTGGTAAGG - Intergenic
1015903449 6:138091393-138091415 ACCTGTTGCCATAGTTGGTAAGG - Exonic
1017538074 6:155369982-155370004 GCCAGGAGCCATGGAGGGGAAGG + Intergenic
1018561256 6:165102835-165102857 GCCTGGAGCCATAGTGGGTGTGG + Intergenic
1019171100 6:170133591-170133613 GGCAGGTGCCTCAGTGGGTAGGG + Intergenic
1024005061 7:45219373-45219395 GCCAGGAGCCTGAGTGGGTCTGG - Intergenic
1025206529 7:56996307-56996329 GGCAGGAGCCACAGTGGGAAGGG + Intergenic
1025665409 7:63580620-63580642 GGCAGGAGCCACAGTGGGAAGGG - Intergenic
1030713563 7:112782978-112783000 GCCAGGCACTATAGTGGGTGCGG - Intronic
1033056338 7:138058409-138058431 GGCAGGGGCCGTAGTGGGTAGGG - Intronic
1041693826 8:60714938-60714960 CGCAGGCGCCATAGTGGGGAGGG + Intronic
1042687734 8:71461344-71461366 GCCAGCTGCCATGGTGGGGCAGG + Intronic
1043910182 8:85854977-85854999 GAAAGCAGCCATAGTGGGTATGG - Intergenic
1054728253 9:68674486-68674508 GCCCGGTGCCTTGGTGGGTACGG - Intergenic
1058889136 9:109345797-109345819 GCCTGGTTCCATCGTGGGTCGGG - Intergenic
1061068710 9:128295484-128295506 CCCAGGTGTCATAGTGGGCACGG + Intergenic
1186338864 X:8622079-8622101 ACCAGGGGTCATAGTGGGTTTGG - Intronic
1198117629 X:133559403-133559425 GCCAGGTGCCATAGTGGGTACGG + Intronic
1198518324 X:137429312-137429334 GACAGGGGCCTTAGAGGGTATGG + Intergenic