ID: 1198125017

View in Genome Browser
Species Human (GRCh38)
Location X:133635025-133635047
Sequence CTATAATCATGCCGTCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 43}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198125011_1198125017 -1 Left 1198125011 X:133635003-133635025 CCCTGTCCTAGCATTCAACCACC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 1198125017 X:133635025-133635047 CTATAATCATGCCGTCGGCCAGG 0: 1
1: 0
2: 0
3: 0
4: 43
1198125010_1198125017 0 Left 1198125010 X:133635002-133635024 CCCCTGTCCTAGCATTCAACCAC 0: 1
1: 0
2: 2
3: 3
4: 107
Right 1198125017 X:133635025-133635047 CTATAATCATGCCGTCGGCCAGG 0: 1
1: 0
2: 0
3: 0
4: 43
1198125009_1198125017 3 Left 1198125009 X:133634999-133635021 CCTCCCCTGTCCTAGCATTCAAC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1198125017 X:133635025-133635047 CTATAATCATGCCGTCGGCCAGG 0: 1
1: 0
2: 0
3: 0
4: 43
1198125007_1198125017 15 Left 1198125007 X:133634987-133635009 CCTTACCAGACTCCTCCCCTGTC 0: 1
1: 0
2: 1
3: 33
4: 346
Right 1198125017 X:133635025-133635047 CTATAATCATGCCGTCGGCCAGG 0: 1
1: 0
2: 0
3: 0
4: 43
1198125012_1198125017 -2 Left 1198125012 X:133635004-133635026 CCTGTCCTAGCATTCAACCACCT 0: 1
1: 0
2: 0
3: 4
4: 107
Right 1198125017 X:133635025-133635047 CTATAATCATGCCGTCGGCCAGG 0: 1
1: 0
2: 0
3: 0
4: 43
1198125013_1198125017 -7 Left 1198125013 X:133635009-133635031 CCTAGCATTCAACCACCTATAAT 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1198125017 X:133635025-133635047 CTATAATCATGCCGTCGGCCAGG 0: 1
1: 0
2: 0
3: 0
4: 43
1198125006_1198125017 24 Left 1198125006 X:133634978-133635000 CCAGCAGTACCTTACCAGACTCC 0: 1
1: 0
2: 1
3: 8
4: 93
Right 1198125017 X:133635025-133635047 CTATAATCATGCCGTCGGCCAGG 0: 1
1: 0
2: 0
3: 0
4: 43
1198125008_1198125017 10 Left 1198125008 X:133634992-133635014 CCAGACTCCTCCCCTGTCCTAGC 0: 1
1: 0
2: 3
3: 29
4: 387
Right 1198125017 X:133635025-133635047 CTATAATCATGCCGTCGGCCAGG 0: 1
1: 0
2: 0
3: 0
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198125017 Original CRISPR CTATAATCATGCCGTCGGCC AGG Intronic
923084991 1:230696491-230696513 CTAAACTCATGGCGTCAGCCGGG + Intergenic
1076375056 10:129978077-129978099 CTGAAATCATGCTGTCAGCCTGG - Intergenic
1080403862 11:31961224-31961246 CTAAAATCAAGGTGTCGGCCGGG + Intronic
1091022402 11:132112626-132112648 CTCTAATCATGACGTCCCCCCGG + Intronic
1091771951 12:3157860-3157882 CTATAATCATGTCTGAGGCCAGG - Intronic
1093196142 12:16131650-16131672 TTAAAAGCATGCGGTCGGCCAGG - Intergenic
1107327850 13:39264381-39264403 CTACAACCATGCTGTTGGCCTGG + Intergenic
1109135251 13:58641377-58641399 CTATGATCATGCCACTGGCCTGG - Intergenic
1112715708 13:102182350-102182372 CTAAAATCAAGGCGTCGGCAGGG - Intronic
1114742227 14:25109050-25109072 ATATAATCATGGGGTTGGCCAGG + Intergenic
1124069179 15:26375617-26375639 CTATACTCATGTTGTAGGCCTGG + Intergenic
1128037044 15:64536315-64536337 CTAAAATCATGCCATAGGCTGGG - Intronic
1135572186 16:23557735-23557757 CAATCATCATGGCGGCGGCCGGG + Exonic
1144820534 17:18070278-18070300 CTATAAGAATGCTGTCGGCTGGG + Intergenic
1151153414 17:72107419-72107441 CTGCAAACATGCCGTCAGCCAGG - Intergenic
1162890651 19:13730766-13730788 CCATTCTCATGCCCTCGGCCAGG + Intergenic
1166722874 19:45007560-45007582 CTAAAATCATGCCCATGGCCAGG + Intronic
1167189273 19:47972920-47972942 CTATAATAATGTAGGCGGCCGGG + Intronic
926485941 2:13458293-13458315 CTGTCATCATGCAGTGGGCCAGG - Intergenic
926734856 2:16065562-16065584 CTAAAATCATGCCTTAGGCTGGG + Intergenic
927270536 2:21204997-21205019 CTATAATCATGTAGTTGCCCTGG + Intergenic
927988803 2:27432624-27432646 CTATGATCATGCCATTGGCTAGG - Intronic
941805713 2:169710251-169710273 CTATAATCAAGGTGTCAGCCTGG - Intronic
944189408 2:196985226-196985248 CTGTAATCATGGTGTTGGCCTGG - Intronic
948026599 2:234782926-234782948 CTAAAATCAAGGTGTCGGCCCGG - Intergenic
948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG + Intronic
1173796331 20:45862929-45862951 ATATAATAATGCAGTGGGCCAGG - Intronic
1178049264 21:28730490-28730512 CTATAATCAAGGTGTTGGCCAGG + Intergenic
1178809983 21:35872710-35872732 CTATGATCATGCCCACGGACAGG + Intronic
954540383 3:51389779-51389801 CTATAAAGATGCTGTTGGCCTGG + Intergenic
971470337 4:27018207-27018229 CTAAAATCATGGTGTTGGCCAGG + Intronic
976946144 4:90770187-90770209 TTGTAATCATGCTGTAGGCCAGG - Intronic
994999138 5:107104867-107104889 TTATAGTCATGCTGTCAGCCAGG - Intergenic
1003840750 6:10116891-10116913 CTATAATCAAGGTGTCAGCCAGG + Intronic
1008334618 6:50286967-50286989 CTAAAATCATGGCTTCGACCAGG - Intergenic
1018374626 6:163199468-163199490 CTATTATCATCCCGTTTGCCTGG + Intronic
1021837665 7:24696309-24696331 CTAAAATCAGGGTGTCGGCCGGG + Intergenic
1023754195 7:43400826-43400848 CTAAAATCAAGCTGTCAGCCAGG + Intronic
1024781870 7:52860424-52860446 CTATAATCATGTTGTGGGGCTGG - Intergenic
1038346442 8:26736612-26736634 CTGTGATCATGCCATCAGCCTGG - Intergenic
1039552667 8:38454240-38454262 TTATACTCATCCCGTCGGGCTGG + Intronic
1188047393 X:25442209-25442231 CTATAATCATGCAATGGGGCTGG + Intergenic
1189689113 X:43597113-43597135 TTATAATCAAGATGTCGGCCAGG + Intergenic
1198125017 X:133635025-133635047 CTATAATCATGCCGTCGGCCAGG + Intronic