ID: 1198126939

View in Genome Browser
Species Human (GRCh38)
Location X:133654193-133654215
Sequence GCTATTGTGTTAGGTGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198126939 Original CRISPR GCTATTGTGTTAGGTGCCAT GGG Intronic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
903770655 1:25762002-25762024 GATATTGTGTTAAGTGAAATAGG - Intronic
906681830 1:47732052-47732074 ACAATTGTGTTTGGTCCCATGGG - Intergenic
907579986 1:55563156-55563178 GATATTATGTTCGGTTCCATTGG + Intergenic
907973307 1:59406273-59406295 GGTGTTGTGTTATTTGCCATCGG - Intronic
907976558 1:59436471-59436493 GCTGTTGTTGTAGGGGCCATGGG - Intronic
917698874 1:177559909-177559931 GCTAAACTGTTAGGTGCCATTGG - Intergenic
917875989 1:179287517-179287539 GGTATTGCGTTAGGTGCTTTGGG + Intergenic
917904915 1:179579171-179579193 GCAATTTTGTTTGATGCCATGGG - Intergenic
918062344 1:181072827-181072849 GCTACTGTCATAGGTGCCAGAGG + Intergenic
921077720 1:211712956-211712978 GCTTTTGTGCGCGGTGCCATAGG - Intergenic
921595111 1:217046267-217046289 GATACTGTGCTAGGTGCTATAGG - Intronic
922797156 1:228345833-228345855 GCTCTTGTGGTAGATGTCATAGG + Intronic
1067257446 10:44657045-44657067 AGTATTGTGTTAGCTGCCCTAGG + Intergenic
1071731615 10:88253867-88253889 GCTAAGGTGTTAGGTGGCAAAGG + Intergenic
1071733776 10:88275061-88275083 GCCATTGTGTTGGGTGGCACTGG - Intronic
1076157634 10:128215917-128215939 GCTGCTGTGTTAGGTGGGATCGG + Intergenic
1080322232 11:31023955-31023977 CCTATTGTTTTAGGTACAATTGG - Intronic
1081880273 11:46444185-46444207 TTTATTGTGTTACGTGCCAGGGG - Intronic
1083687852 11:64387914-64387936 GCTATAGTGTTGGGTGTCAATGG + Intergenic
1086377646 11:86217403-86217425 GTTATTGTGTTAGAACCCATAGG + Intergenic
1090147668 11:124342879-124342901 GATATTTTGTTAGGAGCCACTGG - Intergenic
1095714788 12:45331716-45331738 GCTATTCAATTAGGTGGCATAGG + Intronic
1099019878 12:77390326-77390348 GGTATCTTGTTAGGTGCTATTGG + Intergenic
1099604895 12:84791465-84791487 GATAGTGTGTGAGATGCCATGGG - Intergenic
1102193112 12:111004252-111004274 GCAATTGTGCTAGGAGCCACAGG + Intergenic
1102215053 12:111154958-111154980 GCTGCTGTGGTAGGTGCTATGGG + Intronic
1106772355 13:32974019-32974041 GCTATTGTCTCTGGTGCCAGTGG + Intergenic
1106979944 13:35267467-35267489 GCTTTTGTTTTCTGTGCCATTGG - Intronic
1107058386 13:36130865-36130887 CCTCTTTTGTTTGGTGCCATGGG - Intronic
1107511880 13:41093423-41093445 GCTAGTGAGTGAGTTGCCATAGG + Intergenic
1114811628 14:25907339-25907361 TTTCTTGTGTTAGGTGCCACTGG + Intergenic
1120532665 14:85652444-85652466 GCCATTTTGTTTGTTGCCATAGG + Exonic
1121924489 14:97915436-97915458 GCTAGTGTGCTAGGGGTCATTGG + Intergenic
1124819962 15:33034911-33034933 GCTTTTGTGTTGGGTGAAATGGG - Intronic
1127956573 15:63858991-63859013 GCTGTTGTGTTGGTTGTCATGGG + Intergenic
1128338941 15:66806484-66806506 GCTATAGTTATAGGTGCCAAAGG - Intergenic
1137070639 16:35901676-35901698 GGTTTTCTGTTAGGTGCCTTTGG - Intergenic
1138862350 16:60773969-60773991 GATATTGTGTTAGGTGTAAATGG + Intergenic
1142796516 17:2311821-2311843 GCTATTGTATTTTGTTCCATTGG - Intronic
1152315729 17:79579314-79579336 GCTTTTCTGGTAGGAGCCATGGG - Intergenic
1154535824 18:15409847-15409869 GATATTTTCTTTGGTGCCATCGG - Intergenic
1157447463 18:47756099-47756121 ACTATTGTTTTAGGTGCCCAGGG - Intergenic
1159499202 18:69247327-69247349 AACAATGTGTTAGGTGCCATGGG - Intergenic
1164504247 19:28845721-28845743 CCTAGTGTGTAAGGTGCCTTAGG - Intergenic
1164954992 19:32375012-32375034 TATATTGGGTTAGGTGCTATTGG + Intronic
1168127034 19:54290064-54290086 GCATTTGTGTCTGGTGCCATTGG + Intergenic
926180611 2:10639618-10639640 GGTTTTGGGTTGGGTGCCATAGG + Intronic
928336586 2:30403813-30403835 ACTATTGTGCTAGGTGCTATTGG - Intergenic
928420739 2:31136567-31136589 GGCAGTGTGTTAGGTGCTATGGG - Intronic
928717618 2:34080340-34080362 GCTATTATTTTATCTGCCATAGG - Intergenic
929390611 2:41464632-41464654 GATAATATGTTAGGTGCCAGTGG - Intergenic
938970521 2:136426882-136426904 GACACTGTGTTAGGTGCCAGGGG + Intergenic
939103508 2:137923547-137923569 TCTAATTTGTTAAGTGCCATGGG + Intergenic
939296638 2:140274468-140274490 ACAAGTGTGTAAGGTGCCATGGG - Exonic
946126832 2:217570055-217570077 GCATTTGTGTTGGGTGTCATTGG - Intronic
946179273 2:217940161-217940183 GCTATTGAGCGAGGGGCCATTGG + Intronic
1172369018 20:34372778-34372800 GCTATTGTGCTAGGTTCCAAGGG + Intronic
1175070042 20:56325390-56325412 GCTAATGTGTAAGGTGACAAAGG + Intergenic
1175607178 20:60320744-60320766 GCCATTGTGCTAGGTGTCCTGGG - Intergenic
1177040645 21:16105894-16105916 GCTATGAGGTTAGGTGCCTTGGG - Intergenic
1181786444 22:25230731-25230753 GGCATTGTGTTAGGTGCCCAGGG + Intronic
1181818613 22:25458557-25458579 GGCATTGTGTTAGGTGCCCAGGG + Intergenic
1183771340 22:39928554-39928576 CCTACTGTGTTGGGTGCTATGGG + Intronic
950115857 3:10449976-10449998 GCTGGTGTGTTAGGGGGCATGGG - Intronic
951627099 3:24677627-24677649 GCTATTGTGTTATATATCATGGG + Intergenic
954092762 3:48298362-48298384 GCTACTGCTTCAGGTGCCATTGG - Intronic
958545602 3:95545254-95545276 GCTATAGTTGTAGGTGCCAGTGG - Intergenic
959449854 3:106485796-106485818 ACTATTGTCTTTGCTGCCATGGG - Intergenic
962864027 3:139432048-139432070 GCTGTTGTGTTAAGTACCAAGGG + Intergenic
962987412 3:140548099-140548121 GCTCTGGTGCTAGGTGCCCTTGG + Intronic
965966232 3:174493786-174493808 AGTATTTTGTTAGGTGCTATGGG + Intronic
971425710 4:26512940-26512962 TATGTTGTGTTAAGTGCCATGGG + Intergenic
973197086 4:47457309-47457331 GCTATGGTGTTAGGTGCAGAGGG - Intronic
974501792 4:62714163-62714185 ACTAATGTGTCAGGTGCCTTGGG + Intergenic
975645540 4:76542377-76542399 TATGTTGTGTTACGTGCCATGGG + Intronic
977784274 4:101014985-101015007 GCTATTGTGACAGGTTACATGGG - Intergenic
978480123 4:109179298-109179320 GCTGTTGTGTCAGGTGCAGTGGG - Intronic
986725728 5:10595006-10595028 GCTCTTGAGTTACTTGCCATAGG - Intronic
990248745 5:53891428-53891450 TCTACTGAGTTAGATGCCATGGG + Intronic
992015943 5:72575354-72575376 GCTTTTATGTTGGGTGGCATGGG - Intergenic
995965739 5:117906009-117906031 TCTATTGTTTTGGGTGCCCTTGG + Intergenic
998351258 5:141503142-141503164 GCAATTGTGATACTTGCCATGGG - Intronic
998566141 5:143217570-143217592 GGTGCTGTGTTAGGTACCATGGG - Intronic
1001364352 5:171122029-171122051 GCCATTGTTTTTGGTGGCATTGG + Intronic
1005697822 6:28367592-28367614 TCTATTGTTTTAGGAGGCATTGG - Exonic
1009506552 6:64488425-64488447 GCTATTGTGGTTGGCACCATGGG + Intronic
1011873240 6:91923724-91923746 GATATTATGTTAAGTGACATAGG + Intergenic
1012080122 6:94747311-94747333 AGTAATGTGTTAGGTGCCATTGG + Intergenic
1014282443 6:119456917-119456939 GCTAATGTCTTCTGTGCCATGGG - Intergenic
1014801111 6:125778867-125778889 TCCATTGTGATAGGTGCCATGGG - Intergenic
1015395460 6:132729008-132729030 GCTGTTGTGTTATGGGCAATGGG - Intronic
1020502422 7:8940206-8940228 AAGATTGTGTTAGGTTCCATAGG - Intergenic
1022799158 7:33759192-33759214 TCTAAGGTGTTGGGTGCCATTGG - Intergenic
1024854016 7:53755571-53755593 GCTCTTGTTGTAGGTGCCAAAGG + Intergenic
1025834808 7:65084617-65084639 GCTATTGTGTTAACTCCCAGTGG + Intergenic
1025904579 7:65774094-65774116 GCTATTGTGTTAACTCCCAGTGG + Intergenic
1026263863 7:68779244-68779266 ACTATTCTGTTAAGTGCCCTTGG + Intergenic
1028324904 7:89510936-89510958 GCTATTGTGTTTGGTGGTTTAGG - Intergenic
1036444357 8:8808771-8808793 GCAATTGGGTTTGGTGCCATTGG + Intronic
1038477174 8:27876585-27876607 GCAATTGTGACAGCTGCCATTGG + Intronic
1038499512 8:28031900-28031922 GCTCATGAGTTGGGTGCCATTGG + Intronic
1041979178 8:63836090-63836112 GCTATAGAGTTAGGTGGAATTGG + Intergenic
1042720064 8:71818012-71818034 CCTATTGTGGTAGGTGGAATGGG + Intergenic
1045184422 8:99822561-99822583 GCTACTTTGTTAGGTGCTAGAGG - Intronic
1046939738 8:119919237-119919259 GCTATTATATTAGGTTCCTTTGG + Intronic
1049607409 8:143536179-143536201 GCTGGCGTGTTAGGAGCCATGGG - Intronic
1050804755 9:9660218-9660240 GATATTATTTTAGGTGACATCGG + Intronic
1051417289 9:16855364-16855386 GATACTCTATTAGGTGCCATAGG - Intronic
1187069244 X:15871778-15871800 GCTTGTGTGTTAGGTGCTTTGGG - Intergenic
1187200007 X:17125772-17125794 GGGATTGTGTTGTGTGCCATAGG + Intronic
1198126939 X:133654193-133654215 GCTATTGTGTTAGGTGCCATGGG + Intronic
1199467847 X:148159878-148159900 GCTATTGTGTCTGGTGCAATGGG + Intergenic