ID: 1198127415

View in Genome Browser
Species Human (GRCh38)
Location X:133659617-133659639
Sequence CCTCCCTCAAGGAGGCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 297}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198127411_1198127415 -2 Left 1198127411 X:133659596-133659618 CCACTTCTTATGCTTATGCTTCC 0: 1
1: 0
2: 0
3: 20
4: 312
Right 1198127415 X:133659617-133659639 CCTCCCTCAAGGAGGCTGTGAGG 0: 1
1: 0
2: 1
3: 38
4: 297
1198127410_1198127415 15 Left 1198127410 X:133659579-133659601 CCTTTATCTTTATTTAACCACTT 0: 1
1: 0
2: 2
3: 52
4: 653
Right 1198127415 X:133659617-133659639 CCTCCCTCAAGGAGGCTGTGAGG 0: 1
1: 0
2: 1
3: 38
4: 297
1198127409_1198127415 16 Left 1198127409 X:133659578-133659600 CCCTTTATCTTTATTTAACCACT 0: 1
1: 0
2: 6
3: 51
4: 734
Right 1198127415 X:133659617-133659639 CCTCCCTCAAGGAGGCTGTGAGG 0: 1
1: 0
2: 1
3: 38
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198127415 Original CRISPR CCTCCCTCAAGGAGGCTGTG AGG Intronic
900300164 1:1973169-1973191 CCTCCCCAAGGGAGGCTGTGCGG - Intronic
900573993 1:3374053-3374075 ACTCCCTCCAGGAGGGTATGGGG - Intronic
901025731 1:6277827-6277849 CCTCCCTCTGAGAGGGTGTGAGG + Intronic
901181727 1:7346745-7346767 CGGCCCTGAAGGAGGCTGTTTGG + Intronic
901658797 1:10786050-10786072 CCTCGCAGATGGAGGCTGTGTGG - Intronic
902193347 1:14779312-14779334 CCTGCCACTAGGAGGCAGTGTGG + Intronic
902659716 1:17892633-17892655 TCTTCCCCAAGGAGGCTGGGTGG + Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902928941 1:19716863-19716885 CCAGCCTCAAGGAAGCTGAGCGG + Intronic
903357476 1:22756749-22756771 CACCCCTCAAGGTGTCTGTGAGG - Intronic
903440118 1:23381517-23381539 CATCCTCCAAGGAGGCTGTGGGG + Intronic
904353641 1:29924685-29924707 CCCACCTCTAGGAGGCTGAGAGG - Intergenic
905872188 1:41411296-41411318 CCTCCCTCCAGCAGTCAGTGTGG + Intergenic
905872591 1:41413556-41413578 GCTCCCACCAGGGGGCTGTGGGG + Intergenic
905930074 1:41780575-41780597 CATCCCTGCAGGAGGCTCTGGGG + Intronic
906248509 1:44293761-44293783 CCTTCCTCAAAGAAGCTGTGTGG - Intronic
907260298 1:53213154-53213176 CCACTCTCAAGGATGCTGTGAGG + Intronic
910776558 1:90882171-90882193 TGGCCCTCAAGGAGGCTGTTGGG + Intergenic
912519144 1:110233529-110233551 CCCCCCACAACGAGGATGTGGGG - Exonic
914338731 1:146740032-146740054 CCTCCCACAATGAGGGTGGGGGG + Intergenic
915102158 1:153508293-153508315 CACCCCGCAAGGAGTCTGTGTGG + Intergenic
920185408 1:204156307-204156329 CCTCCCCCAGGGTGTCTGTGGGG - Exonic
920350675 1:205335970-205335992 CCTCCCTCCAGGAGGCTCCCTGG + Intergenic
920933226 1:210408100-210408122 CCTCCCTCAGGATTGCTGTGAGG + Intronic
920979082 1:210815276-210815298 CCTCCCTCAAGGAGGAAGGATGG + Intronic
922616199 1:226962625-226962647 CCGCCCTCCTGCAGGCTGTGAGG + Intronic
922641414 1:227235638-227235660 CAGCCCTCAAGGAGGCTGAGAGG - Intronic
922792770 1:228319205-228319227 CCTACCTCAAGAAGGCTGGGAGG + Exonic
1065176330 10:23079763-23079785 GCTTCCTGAAGGAGGCAGTGGGG + Intergenic
1066366064 10:34777920-34777942 CCTCCCGCAAGGAGGCCTTTGGG + Intronic
1068661415 10:59627099-59627121 CCTCCGTCAAGCTGGCTGGGTGG - Intergenic
1069307441 10:66988241-66988263 CCTACCTCAATGATCCTGTGAGG - Intronic
1070711358 10:78685423-78685445 CATCCCCAAAGAAGGCTGTGTGG - Intergenic
1073328520 10:102656450-102656472 CTTCCCTCCAAGAGGCAGTGTGG + Intronic
1073374482 10:103021233-103021255 CCTTCGTCAGGGAGGCTGTGGGG - Intronic
1073904204 10:108258569-108258591 GCTCCCAGAAGGAGGCTGTTGGG - Intergenic
1074445712 10:113519726-113519748 CCTCCGGCCAGGAGGCTGAGAGG - Intergenic
1074865138 10:117540510-117540532 CCTCTCTCAATTAGGCTGTGAGG - Intergenic
1075571959 10:123552657-123552679 CCTCCCTCAAAGGGACTGTAAGG - Intergenic
1075599985 10:123760747-123760769 GCTCCCTCTAGGAAGCTGTGAGG - Intronic
1076549259 10:131267456-131267478 CCCCCCTCAAGTTGGCAGTGTGG - Intronic
1076603168 10:131672187-131672209 CCTGCCTCAAGGAGGCCGAATGG + Intergenic
1076720351 10:132389668-132389690 CCTCCCTCAGGCATCCTGTGGGG + Intergenic
1077243487 11:1524335-1524357 GCTCCATCCAGAAGGCTGTGAGG - Intergenic
1077485309 11:2835795-2835817 CCTTCCTCATGGAGGCGGCGGGG + Intronic
1077991380 11:7415211-7415233 CTCCCTGCAAGGAGGCTGTGCGG + Intronic
1080697011 11:34611473-34611495 CATCCCCCAAGGCTGCTGTGAGG - Intergenic
1081810221 11:45910227-45910249 CCTCCCGGAAGGAGGGTGTGGGG - Intronic
1082874278 11:57972282-57972304 CCTGCCTCAAGGTGGGTGTAGGG - Intergenic
1084195987 11:67523818-67523840 CCTCTTTCTGGGAGGCTGTGTGG - Intergenic
1084360218 11:68664388-68664410 CCACCCTCGAGGTGGCTGGGCGG - Intergenic
1085519903 11:77131639-77131661 CCTCCCTCAGGGGGCCTCTGAGG + Intronic
1087305688 11:96487044-96487066 CCTCCCCAAGGGAAGCTGTGAGG + Intronic
1088606754 11:111540604-111540626 CCTCGCTGGAGGAGGCTGTCGGG + Intronic
1089768214 11:120783974-120783996 CCAGCCTCAGGGAGGCTGAGGGG + Intronic
1090229930 11:125094804-125094826 CCTCCTTCCAGGAAGCAGTGAGG + Intergenic
1090532183 11:127602049-127602071 CCTCCCTCCAGGACAATGTGAGG - Intergenic
1091283405 11:134395116-134395138 CCTCCTGCATGGAGGCTCTGGGG - Intronic
1092247317 12:6871024-6871046 CCTCCCTCCAAGTGGCTCTGGGG + Exonic
1092428601 12:8392168-8392190 CCACCCTCAGGGCTGCTGTGGGG - Intergenic
1092429681 12:8398312-8398334 CCACCCTCAGGGCTGCTGTGGGG - Intergenic
1093773648 12:23047223-23047245 CCTCCCTCATGGAGTTTTTGAGG + Intergenic
1094224141 12:28026689-28026711 CACCTGTCAAGGAGGCTGTGCGG - Intergenic
1095646936 12:44558589-44558611 CCTCCCTAAGGGAAGCTGTGAGG + Intronic
1096680428 12:53252136-53252158 GCTCCCGGAAGCAGGCTGTGAGG + Intronic
1098164303 12:67677826-67677848 CCTGCCTCAGGGATGTTGTGAGG + Intergenic
1100190572 12:92186780-92186802 CCTCCCAAAAGGAGGGTGAGGGG + Intergenic
1100404584 12:94262479-94262501 CTTTGCTCAAGGAGGCTGTTTGG - Intronic
1101091493 12:101291216-101291238 TCTCCCTCAGGGTTGCTGTGAGG + Intronic
1101728145 12:107404893-107404915 CTTCCCTGTAGGAGGCTATGAGG - Intronic
1103393247 12:120589264-120589286 CCTCCCTCAAGGACCCTGGGGGG + Intergenic
1103747763 12:123137533-123137555 GGTCCCTCAAGGCTGCTGTGTGG - Intronic
1104944689 12:132410362-132410384 CGTCCATCAAGGAGGGTGAGGGG - Intergenic
1106805603 13:33303321-33303343 TCTCCCTCAGAGAGGCAGTGTGG + Intronic
1107826032 13:44330031-44330053 TCTCCGTCCAGGAGGCTGTGGGG + Intergenic
1108068241 13:46601137-46601159 CCTACCTCATGGATGCTTTGAGG + Intronic
1108400418 13:50036289-50036311 CCTCTCTGAGGGTGGCTGTGAGG + Intergenic
1108526000 13:51286547-51286569 CATCCCTGAAGGTGGCTGTGGGG + Intergenic
1108605192 13:52030495-52030517 CCTCACGGAAGGAGACTGTGTGG - Exonic
1110551293 13:76813854-76813876 CCTCGCACAAGGAGACAGTGAGG - Intergenic
1113462400 13:110491357-110491379 CCTGCCTGAGGAAGGCTGTGTGG - Intronic
1117334382 14:54744396-54744418 CCAGCCACAGGGAGGCTGTGCGG - Intronic
1119387726 14:74268199-74268221 CTACCCTCACTGAGGCTGTGTGG - Intergenic
1119783113 14:77291653-77291675 CCTCCCTCTAGAAGGCTGGATGG - Intronic
1121790924 14:96699068-96699090 CCTCTCTCAGAGTGGCTGTGAGG + Intergenic
1122862365 14:104588366-104588388 CCTCCCTCGGGGAGGGAGTGAGG - Intronic
1123058973 14:105585904-105585926 ACTCCCACAAGGGGGCAGTGAGG - Intergenic
1123083301 14:105706135-105706157 ACTCCCACAAGGGGGCAGTGGGG - Intergenic
1123129424 14:105973713-105973735 CATCCCTGAAGGAGGCTGCTAGG + Intergenic
1123130515 14:105981920-105981942 CATCCCTGAAGGAGGCTGCTAGG - Intergenic
1123409940 15:20049879-20049901 CATCCCTGAAGGAGGCTGCTAGG + Intergenic
1123519272 15:21056586-21056608 CATCCCTGAAGGAGGCTGTTAGG + Intergenic
1123900352 15:24870712-24870734 CCTCACTAAAGGAAGCTGGGAGG - Intronic
1124425693 15:29560688-29560710 CCTCCCTAGATGAGGCTGTGGGG - Intronic
1128104160 15:65030687-65030709 CTCCACTCAAGGAGGCTTTGGGG - Intergenic
1129616721 15:77104710-77104732 CCTCACTCCAGGAAGCTGGGAGG + Exonic
1129726759 15:77905405-77905427 GCTCCCACCAGGAGGCTGCGTGG + Intergenic
1129792463 15:78350451-78350473 CCTTCCTCTAAGAAGCTGTGGGG - Intergenic
1130421131 15:83748162-83748184 CCTCTTACAAGGAGCCTGTGGGG + Intronic
1130895645 15:88168632-88168654 ACTCCCTGCAGGAGGCAGTGGGG - Intronic
1131074639 15:89487299-89487321 CATCTCTCAAGGAGGGTGTTTGG - Intronic
1134187054 16:12092662-12092684 CTTCCCTCAAGGATTCTTTGTGG + Intronic
1136026021 16:27469615-27469637 CCTCCCTCAAGAGGCCTCTGTGG + Intronic
1136082398 16:27860710-27860732 CCTCCCTGCAGAAGGCTGTTTGG - Intronic
1136691308 16:32032781-32032803 CATCCATCAGTGAGGCTGTGTGG + Intergenic
1136791896 16:32976346-32976368 CATCCATCAGTGAGGCTGTGTGG + Intergenic
1136877921 16:33877562-33877584 CATCCATCAGTGAGGCTGTGTGG - Intergenic
1137481984 16:48859451-48859473 GCTTCATCAAGGAGGCTGGGAGG - Intergenic
1138318418 16:56090224-56090246 CCTGCTTCCAGGAAGCTGTGGGG - Intergenic
1139612834 16:68071050-68071072 TCTTCCTCAAGGAGGGTCTGCGG + Exonic
1139949753 16:70663186-70663208 TCTCCCTCCAGGAGGCGGGGCGG - Exonic
1139995546 16:70977322-70977344 CCTCCCACAATGAGGGTGGGGGG - Intronic
1141064480 16:80902769-80902791 TCTCCCTCCAGGAGGCTGGGTGG - Intergenic
1141867009 16:86757318-86757340 CCTGGCCCATGGAGGCTGTGTGG - Intergenic
1203094107 16_KI270728v1_random:1237810-1237832 CATCCATCAGTGAGGCTGTGTGG + Intergenic
1142672959 17:1495855-1495877 CCTCCCTCAAGGAGCCAGGCGGG + Exonic
1146672500 17:34751270-34751292 CCTCCCTCAGAGATGTTGTGAGG - Intergenic
1146907269 17:36625901-36625923 CCTCCCAGAAAGTGGCTGTGGGG - Intergenic
1147056631 17:37839860-37839882 CCCCTCTCGAGGAGGCAGTGGGG + Intergenic
1147359227 17:39920863-39920885 AATCCCCCAAGGGGGCTGTGAGG - Intergenic
1147384085 17:40071604-40071626 CCTGCCCCAAGGAGGCCGAGGGG - Intronic
1147869887 17:43579606-43579628 CCTCCCTTAAGGAAGCAGTGAGG - Intronic
1148153180 17:45408515-45408537 CCTTCCTCCAGGCTGCTGTGTGG + Intronic
1148682787 17:49484265-49484287 CCTGCCTGCAGGGGGCTGTGAGG + Intergenic
1149611691 17:57962219-57962241 GCTCCCTAGAGGAGGTTGTGGGG + Intergenic
1150456211 17:65308854-65308876 CCTCCCAGAAGCAGCCTGTGGGG - Intergenic
1151153822 17:72110582-72110604 CATATCTCTAGGAGGCTGTGAGG - Intergenic
1151193542 17:72415769-72415791 CCTCCCTCTGGGAGGGTGAGAGG + Intergenic
1151329782 17:73399943-73399965 CCTCCCTCAGGGTTGTTGTGAGG + Intronic
1151348836 17:73519584-73519606 ACTCCCCTAAGGAGGCTGGGAGG - Intronic
1151581584 17:74982290-74982312 CCTCCCGCAACGCCGCTGTGCGG + Intergenic
1152392875 17:80013208-80013230 CCTCCCGGAAGGAGGGTCTGGGG - Intronic
1152715884 17:81900477-81900499 CCTCCCTCAGGCTGGCTCTGAGG + Intronic
1152901196 17:82941994-82942016 CCTGCCGGAAGGAGGCTGAGAGG - Intronic
1157283009 18:46358507-46358529 CTCCCCTGAAGGAAGCTGTGGGG + Intronic
1157523850 18:48363915-48363937 CCTTCATCTGGGAGGCTGTGGGG - Intronic
1157934798 18:51861051-51861073 CCTCCCTCAAAGAGACATTGTGG - Intergenic
1158524221 18:58197880-58197902 CTTCCCTCAAGCAGGCTCAGGGG - Intronic
1160408647 18:78659985-78660007 GCTCCTTCGAGGAGCCTGTGTGG - Intergenic
1161188457 19:2939030-2939052 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188465 19:2939065-2939087 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188474 19:2939100-2939122 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188483 19:2939135-2939157 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188492 19:2939170-2939192 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188501 19:2939205-2939227 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188510 19:2939240-2939262 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161510702 19:4669704-4669726 CCCCCCTCACCGAGGGTGTGAGG - Intronic
1161567927 19:5013675-5013697 CCTCCCATGAGGAGGCTGTGAGG + Intronic
1161613443 19:5256892-5256914 TCTCCATCCAGGAGGCCGTGTGG - Intronic
1162689109 19:12414122-12414144 GCTGCCGCGAGGAGGCTGTGAGG - Intronic
1163585693 19:18162268-18162290 CCTCCCTGCAGGATGCTGAGTGG + Exonic
1164539779 19:29114050-29114072 GCTCACTCTAGGAGGCTGTGGGG + Intergenic
1164722397 19:30441904-30441926 CCTCCCGCCAGGAGACTGCGTGG - Intronic
1165384215 19:35500978-35501000 CCTCCTTCAAGCACCCTGTGGGG - Intronic
1165390893 19:35538231-35538253 GCTCCCTCAAGGAGCCTGGTTGG - Intronic
1165495263 19:36149012-36149034 CCTCCCTCTAGTAGCCTGTTAGG + Intronic
1166300883 19:41911587-41911609 TCTCCCTCAAGGAGACTGCCTGG - Intronic
1166345657 19:42163620-42163642 CCTCCCTCAGGGAGGGACTGAGG - Intronic
1166934185 19:46321148-46321170 AAGCCCTCAAGGAGGCTGTAAGG - Intronic
1167049406 19:47069250-47069272 CCTCCCTCAGAGAAGCTGTCGGG + Exonic
1167369031 19:49070018-49070040 CCTCCCTCTAGGGAGGTGTGAGG + Exonic
925371591 2:3349437-3349459 CCTCCCTGGAGCTGGCTGTGTGG - Intronic
927865527 2:26585091-26585113 CACCCCTCAAGGTGGCTCTGTGG - Intronic
929929920 2:46245857-46245879 CCACCCTCAAGTAGGCCCTGGGG + Intergenic
930036467 2:47088535-47088557 CCTGCCTCTAGGGGGCTATGAGG + Intronic
931990506 2:67785349-67785371 CCTCCCTCAAGGAGGTTTCCTGG - Intergenic
932104998 2:68934058-68934080 CTTCCCTCAATGAGGATATGAGG - Intergenic
933226949 2:79760860-79760882 CCTACCAAATGGAGGCTGTGGGG + Intronic
933892695 2:86786168-86786190 CCACCCTTAAGGCTGCTGTGAGG - Intronic
933967828 2:87444487-87444509 CCTCACTCATGGAGGCTGCCGGG + Intergenic
934732746 2:96669715-96669737 CTTCCCTGCTGGAGGCTGTGTGG - Intergenic
934765300 2:96877062-96877084 CCTGCCTCATGGGGGTTGTGTGG + Intronic
935108432 2:100068734-100068756 CCACCATCAAGGATGCTGGGAGG + Intronic
936063904 2:109316275-109316297 CCTCGGTCCAGGAGGCTGGGTGG + Intronic
936125837 2:109788587-109788609 TTTCCATCAAGGAGTCTGTGTGG + Intergenic
936218856 2:110582881-110582903 TTTCCATCAAGGAGTCTGTGTGG - Intergenic
936325970 2:111506012-111506034 CCTCACTCATGGAGGCTGCCGGG - Intergenic
936461957 2:112720920-112720942 CCTCCCTCAAAGGGGCTCGGGGG + Intergenic
937151655 2:119690487-119690509 CCTCTCCCCAGCAGGCTGTGAGG + Intergenic
937312144 2:120909045-120909067 CCTCCAGCAGAGAGGCTGTGAGG + Intronic
937433720 2:121862675-121862697 CCTCCCTCAAGGCAGCCATGTGG + Intergenic
938153749 2:128909937-128909959 CCTCACTGAAGGAGGCTGGGGGG - Intergenic
945848604 2:214978942-214978964 CCTACCTCAAGGAGGATATTGGG - Exonic
946522239 2:220479042-220479064 CCTGTCTCAAGGAGACTTTGGGG + Intergenic
948082230 2:235215795-235215817 CATCCCCCATGGAGGCTGGGAGG + Intergenic
948487428 2:238289641-238289663 CCTTTCTCACGGAGCCTGTGGGG - Intronic
948907505 2:240986817-240986839 ACTCCCAGAAGGGGGCTGTGAGG - Intronic
948989152 2:241543045-241543067 GCTGCCTCCAGGAGGCTGGGCGG - Intergenic
948991090 2:241554406-241554428 GCTCACTCAAGGCTGCTGTGTGG - Intergenic
1169209288 20:3756657-3756679 CATCCCTCAAGAAGGCTTTCTGG + Intronic
1169293789 20:4375332-4375354 CTTGGCTCCAGGAGGCTGTGGGG - Intergenic
1171986879 20:31666756-31666778 CCTCCATCACGGGGTCTGTGAGG + Intronic
1172072753 20:32270497-32270519 CTTCCCTCAGGGCTGCTGTGAGG - Intergenic
1173072040 20:39777534-39777556 CCTCTCATAAGGAGGCTGTGAGG - Intergenic
1173530496 20:43766152-43766174 CCTCTCTCACGCTGGCTGTGTGG - Intergenic
1174105403 20:48158515-48158537 CCTCCCTGAAGGATTCTGTTGGG - Intergenic
1174193731 20:48758212-48758234 ACTCCCTGAGGGTGGCTGTGAGG - Intronic
1174483249 20:50845603-50845625 CCTGCCTCAGGGGGGCAGTGGGG - Intronic
1175778412 20:61667205-61667227 CCACCCTCAGGAAGGCTGAGAGG + Intronic
1175889693 20:62310699-62310721 CCGCCCACAAAGAGGGTGTGGGG + Exonic
1176067130 20:63203715-63203737 ACTCCCTCAATGAGGCTCCGTGG - Exonic
1176246990 20:64102176-64102198 CCTCCCTCCAGGGGGCGCTGTGG + Intergenic
1176270052 20:64231640-64231662 CCTCAGTCTGGGAGGCTGTGGGG + Intronic
1176373738 21:6077244-6077266 GCTTCCTCCAGGAGGCTGGGTGG + Intergenic
1177486822 21:21768987-21769009 CCTCCCTCTAGTAGTCTGTAGGG - Intergenic
1179341650 21:40516494-40516516 CCTCTCTCCATGGGGCTGTGAGG + Intronic
1179419265 21:41222754-41222776 CCTCCTCCAAGGAGTCTGTGGGG - Intronic
1179749739 21:43460999-43461021 GCTTCCTCCAGGAGGCTGGGTGG - Intergenic
1180713497 22:17856031-17856053 CCTCCCTTATGGCTGCTGTGAGG + Intronic
1182414820 22:30214595-30214617 CCTCCTTCCAGGTGGCTGTGAGG - Intergenic
1183073147 22:35410314-35410336 GGCCCCTCAAGGAGGCTGGGGGG + Intronic
1183298625 22:37046933-37046955 CCTGCCGCAAGGGTGCTGTGGGG + Intergenic
1183384520 22:37507373-37507395 CCTCACACAAGGAGGCTCGGGGG + Intronic
1183465458 22:37978087-37978109 CCTTCATCGAGGAGGCTGAGCGG - Exonic
1183483337 22:38076544-38076566 CCCCCTTCAGGGAGGCAGTGTGG - Intergenic
1183741265 22:39669908-39669930 CCTCCAGGAAGGTGGCTGTGAGG - Intronic
1184118276 22:42434493-42434515 CCTCTCCCCAGGAGGCTGCGTGG - Intergenic
1184340321 22:43882242-43882264 GCTCCATCATGGAGGCAGTGGGG - Intronic
1184557010 22:45239067-45239089 CCTCCCGCAAGGAGGCTGCAGGG - Intronic
1184565431 22:45288992-45289014 CCACCCACAGGGAGGCGGTGGGG - Intronic
1184887325 22:47354377-47354399 GCTCCATCAGGGAGGCTCTGGGG - Intergenic
950088176 3:10276138-10276160 CCTGCCTCAGGGTGGTTGTGAGG + Intronic
950928045 3:16762486-16762508 CAACCCTCAAGGATGCTTTGAGG - Intergenic
953474162 3:43191977-43191999 CCTTCCTCAAGGAGGCTTATAGG + Intergenic
954673616 3:52303742-52303764 CCCCACTCAAGAAAGCTGTGAGG - Intergenic
954756502 3:52843269-52843291 CCACCCACATGGAGTCTGTGGGG - Intronic
955204628 3:56884651-56884673 CTTCCCTCAAGGACGCTGAGTGG - Intronic
955275956 3:57546917-57546939 ACTCCCTCAAGAAGTCTGTCTGG - Intergenic
955960648 3:64337931-64337953 CCTGCATGAAGGAGGCTGAGAGG + Intronic
963253481 3:143121613-143121635 CCTACCGCAAGGAGGTCGTGGGG + Exonic
964721463 3:159770767-159770789 CCTCCCTTCAGGTGGCTGGGTGG + Intronic
968025837 3:195442365-195442387 GCTCCCTCAAAGAGGGGGTGGGG + Intronic
968511112 4:996353-996375 TCTCCCTAAAGGAGGCAGGGAGG + Intronic
968808305 4:2788803-2788825 ACTCCCTGGGGGAGGCTGTGTGG - Intergenic
969254445 4:5992727-5992749 CCTGCCTCATGCAGGCTATGTGG - Intergenic
969511343 4:7619714-7619736 TCTCTCTCAAGGAGGCTCGGAGG + Intronic
969604434 4:8195454-8195476 CCTTCCTCTAGGAGGCTGCTGGG + Intronic
970325369 4:14918481-14918503 CTTCCCCCAAGCAGGCTGTCAGG - Intergenic
970365480 4:15354039-15354061 TCTCCCCCAAGGCTGCTGTGTGG + Intronic
972150220 4:36079964-36079986 CCTAAGCCAAGGAGGCTGTGGGG + Intronic
972762641 4:42122003-42122025 CAGCCCTCAGGGAGGCTGGGTGG + Intronic
977818332 4:101442240-101442262 CTGCCCTCAAGGAGGCTGTAGGG - Intronic
977920214 4:102634809-102634831 CCTCACCGAAGGAGGCCGTGGGG - Exonic
978107133 4:104916738-104916760 CCTACCTCAAGGGGCCTGAGGGG - Intergenic
978323037 4:107519229-107519251 CCTCCCACAGGGAGGCAGTGTGG - Intergenic
978398232 4:108305284-108305306 CCTCCTTCAGGGAGGCAGGGAGG + Intergenic
980833297 4:138157826-138157848 CCTAACTCAAGTAGGCTGTCTGG - Intergenic
984591160 4:181619114-181619136 CCTCTCCCAAGGGGGCCGTGAGG + Intergenic
984655125 4:182309153-182309175 CCTCCTTCAAGGAGGAAGTGGGG + Intronic
985129642 4:186726713-186726735 CCTCCCCCTTGGAGGCGGTGGGG + Intronic
985627164 5:995065-995087 TTTCCCTCCAGAAGGCTGTGGGG - Intergenic
987304651 5:16625814-16625836 CCTCCCCAAAAGAAGCTGTGAGG - Intergenic
992094069 5:73344106-73344128 CCTCCCTGCAGGAGGCTGCTTGG - Intergenic
993245830 5:85452076-85452098 CATTCCTCAAGGAGTCTTTGGGG - Intergenic
993593329 5:89823195-89823217 CCTCTCTGTAGGAGGCTCTGGGG - Intergenic
994236453 5:97368966-97368988 AATCCCTCAATGAGGCTCTGTGG + Intergenic
997656819 5:135561418-135561440 CCTCCGTGCAGGCGGCTGTGTGG - Intergenic
997740508 5:136248856-136248878 CTTCTCTCATGGAGGATGTGTGG + Intronic
998107173 5:139476008-139476030 CCTCCCTCACGGTTGTTGTGAGG - Exonic
998594506 5:143514689-143514711 CCTCCATCCAGGATGCTGGGGGG - Intergenic
1000068053 5:157713441-157713463 CCTCTCTCAATGAGTCTGTAGGG - Intergenic
1001475737 5:172049343-172049365 CCTCCCCCACGGAGGCTGTATGG - Intronic
1001516709 5:172360454-172360476 CCTCCCTCCAGCAGTGTGTGAGG - Intronic
1001798619 5:174523907-174523929 CATTCCTCCTGGAGGCTGTGGGG + Intergenic
1002870754 6:1165629-1165651 CCTGGCTCAAGAAGGCTGGGAGG - Intergenic
1006193426 6:32223074-32223096 CCACCCTCAGGGCTGCTGTGTGG - Exonic
1006387404 6:33739008-33739030 CCCCCAGCCAGGAGGCTGTGGGG - Intronic
1006598666 6:35211861-35211883 CCCACCTCAAGGAGGATGTAGGG + Intergenic
1006884225 6:37367197-37367219 TCTCCCTCATGGTGTCTGTGTGG - Intronic
1006920921 6:37626491-37626513 CCTCCTTCAAGGAGCCTTTGGGG + Intergenic
1009608136 6:65900251-65900273 CCTCCCTCAAGAATACTTTGAGG + Intergenic
1010006164 6:70997908-70997930 CCTACCTAAGGGAAGCTGTGAGG + Intergenic
1011250023 6:85361478-85361500 CCTCCCTCAGGGTGGTTGTTTGG + Intergenic
1011332092 6:86220318-86220340 CCTTCCTCAAGGACACTGTTTGG + Intergenic
1014466671 6:121764404-121764426 CCTTCCTCAAGTAGGCCCTGGGG - Intergenic
1014851928 6:126351290-126351312 CCTCCCAAAAGGAGGCTTTTGGG - Intergenic
1019221986 6:170480209-170480231 CTGCCCTCTAGGAGGCTTTGGGG - Intergenic
1019540922 7:1550619-1550641 CCCCTCTCACGGAGGCTGTGGGG + Intronic
1019769679 7:2875971-2875993 CCTCCCTCCAAGAGGCTGTGTGG + Intergenic
1023895221 7:44427482-44427504 ACTCCCTCAAGGATGCTGGTGGG + Intronic
1024986970 7:55202570-55202592 CCTCAGTCAAGGCGCCTGTGGGG - Exonic
1024990506 7:55231628-55231650 CCTCCCTCATGCAGACTGTCTGG + Intronic
1026897978 7:74021598-74021620 GCTCCCTGCAGGCGGCTGTGTGG + Intergenic
1028621318 7:92832791-92832813 CCACCCTGAAGGAGGGTCTGGGG - Intronic
1029522915 7:101075603-101075625 GATCCCTCAAGGAGGGAGTGTGG + Intergenic
1033982383 7:147181302-147181324 CCTTCCTCAAGAAAGGTGTGAGG - Intronic
1035224360 7:157425303-157425325 CCTCCCTCAAGGGTGCTGCAGGG + Intergenic
1035388915 7:158492067-158492089 TCTCCCTCTGGGAGGCAGTGAGG - Intronic
1035472569 7:159119707-159119729 CCACCCTGGAGGATGCTGTGTGG - Intronic
1036307973 8:7615897-7615919 CCTCCCCCAGGGCTGCTGTGAGG + Intergenic
1036531222 8:9589500-9589522 CCTCCCTTAAAGTTGCTGTGAGG + Intronic
1037898672 8:22675127-22675149 CCTCCTTCAAGGAGGCAGCAAGG - Intergenic
1038290040 8:26241102-26241124 CCTCTCCAGAGGAGGCTGTGTGG + Intergenic
1038449628 8:27631691-27631713 CCCCTCTCAAGGTGGTTGTGAGG + Intergenic
1039563030 8:38528363-38528385 CCTCCACCAAGGCTGCTGTGGGG - Exonic
1041801928 8:61809683-61809705 CTCCCCTCCATGAGGCTGTGAGG - Intergenic
1042075813 8:64993479-64993501 CCTCTCTTAAGGAGGCTGGCTGG + Intergenic
1045942667 8:107756633-107756655 CCAACTTCCAGGAGGCTGTGAGG + Intergenic
1046282658 8:112053875-112053897 CTACCCTCAAGTAGGCTCTGGGG + Intergenic
1048035907 8:130676932-130676954 TCTCCCTCAAGGAGGACTTGTGG - Intergenic
1048514240 8:135091363-135091385 CCTCCAGCAAGGAGGCTGGGAGG - Intergenic
1049449893 8:142654974-142654996 CCTGCCCCAAGGTGGCTTTGAGG + Intergenic
1049613789 8:143567706-143567728 CCTCCCCCTGGGGGGCTGTGGGG - Intronic
1049966404 9:784246-784268 CATCCCCCAAGGAGGTTGTGAGG + Intergenic
1052956779 9:34258627-34258649 CCTCTCTCCAGGAAGCAGTGTGG - Intronic
1053417066 9:37953516-37953538 GCTGCCTCCAGGAGGCAGTGGGG + Intronic
1054711602 9:68516473-68516495 GTTACCTCAAGTAGGCTGTGGGG + Intronic
1056289699 9:85130259-85130281 CCTTCCTCCAGGAGGCTGTTGGG - Intergenic
1057217424 9:93236778-93236800 GCACCCTCAAGGAGGAGGTGTGG + Intronic
1057390484 9:94638609-94638631 CCCCCCGCAAGCAGGCTGGGAGG - Intronic
1058947194 9:109868853-109868875 CCTCCCTCAGGAATGTTGTGGGG - Intronic
1059438242 9:114289063-114289085 CCTCCCTGCAGGAGGGTCTGGGG + Intronic
1059544112 9:115159161-115159183 CCTCCCCCAAGAAGGTTCTGAGG - Intronic
1059839768 9:118200772-118200794 CCACCCTCAAGTAGGCCCTGGGG + Intergenic
1060381157 9:123174013-123174035 CTTCCCTCAAGGAGTCAATGGGG + Intronic
1060672785 9:125485034-125485056 AATCCCACATGGAGGCTGTGGGG - Intronic
1060979381 9:127783951-127783973 CCTCCTCCTAGGAGGCTTTGAGG + Intergenic
1061122889 9:128655074-128655096 CCTCTCCCAAGGGGTCTGTGCGG - Intronic
1061425691 9:130496911-130496933 CCTCCCTCCTGGAGGCTGGTTGG + Intronic
1062113863 9:134797076-134797098 CCACCGCCAAGGCGGCTGTGGGG + Intronic
1062277866 9:135739206-135739228 CCTCCCTCAGGGATGGTGTGGGG - Intronic
1062280269 9:135748816-135748838 CCTCCCTCAGGGATGGTGTGGGG - Intronic
1062411213 9:136425646-136425668 CCTCCCCCAAGCAGGCTATTTGG + Intergenic
1062433771 9:136537098-136537120 ACTCCCTCTAGGGGGCTCTGTGG + Intronic
1203774672 EBV:66073-66095 CCTGCCTCCCGGAGGCTCTGCGG + Intergenic
1185611573 X:1396485-1396507 CCTTTCCCAAGGAGGCTGTGTGG - Intergenic
1189241501 X:39528062-39528084 CCTCCCTGAATTGGGCTGTGGGG - Intergenic
1189376993 X:40474227-40474249 CCTTGCTGAAGGAGGCTATGAGG + Intergenic
1190862788 X:54359436-54359458 CCTCAAGCTAGGAGGCTGTGTGG + Intergenic
1194851068 X:98869839-98869861 CCACACTCAAGTAGGCTCTGGGG + Intergenic
1196654419 X:118202140-118202162 CCTCCCTCAATGAAGCCTTGAGG - Intergenic
1196796234 X:119503903-119503925 TCTCGCTCAAGGTGGCAGTGAGG + Intergenic
1197725745 X:129775282-129775304 CCTGCTTCAAGGTGGCTCTGTGG + Intergenic
1198127415 X:133659617-133659639 CCTCCCTCAAGGAGGCTGTGAGG + Intronic
1199120189 X:144043180-144043202 TCTCCCTCACAGAGGCTGTAAGG + Intergenic
1199524959 X:148781911-148781933 CCTAACTAAAGGAAGCTGTGAGG - Intronic
1199944544 X:152654720-152654742 CCTCACTGATGGAGGTTGTGAGG + Exonic