ID: 1198127722

View in Genome Browser
Species Human (GRCh38)
Location X:133662746-133662768
Sequence CCATTGCCAAAGAGAGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 992
Summary {0: 1, 1: 0, 2: 2, 3: 94, 4: 895}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198127719_1198127722 11 Left 1198127719 X:133662712-133662734 CCTTTTGCTTTCATCATGTGGAA 0: 1
1: 0
2: 2
3: 37
4: 402
Right 1198127722 X:133662746-133662768 CCATTGCCAAAGAGAGAAAAAGG 0: 1
1: 0
2: 2
3: 94
4: 895

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198127722 Original CRISPR CCATTGCCAAAGAGAGAAAA AGG Intronic
901424286 1:9171558-9171580 CCAAAGCTAAAGAGAGACAAGGG + Intergenic
901543442 1:9937092-9937114 CCATCTCTAAAGAGAAAAAAAGG + Intronic
902115408 1:14116965-14116987 CCATTACAAATGGGAGAAAATGG - Intergenic
902854311 1:19189181-19189203 CCATTGTCAAAGAGAGCATGGGG + Intronic
903553440 1:24175440-24175462 CCATTCCAAAAGAGAAAAATAGG - Intronic
903614425 1:24641900-24641922 CCATGGAAAAAAAGAGAAAAGGG + Intronic
905408232 1:37752016-37752038 CCACTGCCAAAGACAGAAGCGGG + Intronic
905496180 1:38389788-38389810 CCATTCCAAAAGAGAGAAATTGG + Intergenic
905844567 1:41217915-41217937 CCATTATGAAAGGGAGAAAATGG - Intronic
906991852 1:50747453-50747475 CCATTCCAAAAGGGAGAAAATGG - Intronic
907259495 1:53206669-53206691 CCATTCCAAAAGGGAGAAATTGG - Intronic
907315506 1:53568292-53568314 CCATTGAAAAAGGGAGAAATTGG - Intronic
908176952 1:61565508-61565530 CCATTCCAAAAGGGAGAAATTGG + Intergenic
908391129 1:63684705-63684727 CCATTTCCAAAAATAAAAAAGGG - Intergenic
908879116 1:68710635-68710657 CCATTCCAAAAGAGAGAAATTGG - Intergenic
909086136 1:71172105-71172127 CCATTGCAAATGGGAGAAATTGG + Intergenic
909436450 1:75647765-75647787 CCATTCCAAAAGGGAGAAATTGG - Intergenic
909455591 1:75845432-75845454 CCATTACAAAAGGGAGAAATAGG + Intronic
909457856 1:75870191-75870213 CCATTCCAAATGGGAGAAAATGG - Intronic
909527644 1:76644692-76644714 CCATTCCAAAAGGGAGAAATGGG + Intergenic
909591704 1:77357048-77357070 CCATGCTCAAAGAGAGAGAAGGG - Intronic
909700332 1:78514433-78514455 CCATTCCAAAAGGGAGAAATAGG - Intronic
909728900 1:78870707-78870729 CCATTCCAAAAGGGAGAAATAGG + Intergenic
909756972 1:79239353-79239375 CCATTTCAAATGAGAGAAATTGG + Intergenic
909808736 1:79905298-79905320 CCATTCCAAAAGAGAGAAATTGG + Intergenic
909833965 1:80230696-80230718 CCATTCCAAAAGGGAGAAATTGG + Intergenic
909866946 1:80685842-80685864 CCATTCCAAAAGGGAGAAATTGG + Intergenic
910563473 1:88618090-88618112 CCATTCCAAATGAGAGAAATTGG + Intergenic
910689852 1:89954746-89954768 CCATTCTCAAAAAGAGAAAGTGG - Intergenic
911376463 1:97057247-97057269 CCATTCCAAAAGGGAGAAATTGG - Intergenic
911801031 1:102138295-102138317 ACTTTTCCAAAGAGAGAAAGAGG - Intergenic
911880895 1:103236892-103236914 CCATTCCAAATGAGAGAAATTGG - Intergenic
912004411 1:104879009-104879031 CCATTCCAAATGAGAGAAATTGG - Intergenic
912017513 1:105060410-105060432 CCATTCCAAAAGGGAGAAATTGG + Intergenic
912136267 1:106663127-106663149 CCATTCCAAAAGGGAGAAATTGG - Intergenic
912143139 1:106756342-106756364 CCATTCCAAAAGACAGGAAATGG - Intergenic
912278750 1:108290299-108290321 CCATTCCAAAAGGGAGAAAGAGG + Intergenic
912289476 1:108404058-108404080 CCATTCCAAAAGGGAGAAAGAGG - Intronic
912615588 1:111096825-111096847 CCATTCCAAAAGAGAGAAATTGG + Intergenic
913121631 1:115747171-115747193 CTATTGGCAAAAAAAGAAAAAGG - Intronic
913290458 1:117267081-117267103 CCTTTGCTAAAGAGACAATAAGG + Intergenic
913396559 1:118378068-118378090 CCATTCCAAAAGGGAGAAATTGG - Intergenic
913402300 1:118449403-118449425 CCATTCCAAAAGGGAGAAATTGG - Intergenic
913402720 1:118454374-118454396 CCATTGCAAAAGAAAGAAATTGG + Intergenic
914334459 1:146701764-146701786 CCATTTTTAAAGAGAGTAAAGGG - Intergenic
914453740 1:147816424-147816446 CCATTCCAAAAGGGAGAAATAGG + Intergenic
915398074 1:155601136-155601158 CCATTTCAAAAGAAAAAAAAAGG - Intergenic
916023040 1:160810903-160810925 CCATTCCAAAAGAGAGACATTGG + Intronic
916655873 1:166875272-166875294 CCAAAGCCAAAGAGCAAAAAAGG - Intronic
916829326 1:168474921-168474943 CCATTCCAAAAGGGAGAAATTGG - Intergenic
916982612 1:170154585-170154607 CCATTCCAAAAGGGAGAAATAGG - Intronic
917235545 1:172888307-172888329 CCATTTCAAAAGGGAGAAATTGG + Intergenic
917282096 1:173386909-173386931 CCATTCCCAAAGGAAGAAATAGG - Intergenic
917777353 1:178351773-178351795 CCATTCCAAAAGGGAGAAATTGG + Intronic
917851336 1:179067149-179067171 CCACTGCCAAAAAAAAAAAAAGG + Intronic
918145472 1:181752280-181752302 CCATGGCTAAAGAGAGAAGATGG - Intronic
918230697 1:182528547-182528569 CCATTCCAAAAGGGAGAAATTGG + Intronic
918738951 1:188102996-188103018 CCATTCCACAAGAGAAAAAATGG + Intergenic
918800248 1:188961511-188961533 CCATTCCAAATGAGAGAAATTGG - Intergenic
919177127 1:194033184-194033206 CCATTCCCAAAGGGAGAAATTGG + Intergenic
919371854 1:196738488-196738510 CCATTCCAAAAGGGAGGAAATGG + Intronic
919409598 1:197227297-197227319 CCATTCCAAATGAGAGAAATTGG + Intergenic
919482643 1:198108477-198108499 CCATTCCAAAAGGGAGAAATAGG - Intergenic
919536659 1:198796527-198796549 CCATTCCAAATGGGAGAAAATGG + Intergenic
919940917 1:202285481-202285503 CGATTTCCACAGATAGAAAATGG + Intronic
920161470 1:204001592-204001614 CCATTCCAAAAGGGAGAAACTGG - Intergenic
920325063 1:205156543-205156565 CCATTCCAAATGAGAGAAATTGG - Intronic
920890939 1:209985270-209985292 CCATTCCAAAAGGGAGAAATCGG + Intronic
921121495 1:212141425-212141447 CCAGAGCCAAAGATAGTAAATGG + Intergenic
921487616 1:215733660-215733682 TCATTGCAAAAGGGAGAAATTGG + Intronic
921619331 1:217308878-217308900 CCATTTCAAAAGGGAGAAATAGG - Intergenic
922600388 1:226847056-226847078 TCATTCCAAAAGGGAGAAAATGG - Intergenic
922940585 1:229461524-229461546 AAATTGCCTAACAGAGAAAAAGG + Intronic
923215974 1:231848061-231848083 CCCTGGGCAAAGAGAGAAACAGG + Intronic
923411026 1:233709202-233709224 CCATTGACAAAGAGAAAACTTGG + Intergenic
923760117 1:236834505-236834527 CCAAGGCCACATAGAGAAAAAGG - Intronic
923856939 1:237855340-237855362 ACATTACAAAAGATAGAAAACGG + Intergenic
924259654 1:242216255-242216277 CCAATGCAAAAAACAGAAAAGGG + Intronic
924507706 1:244701644-244701666 CCGTTCCAAAAGGGAGAAAATGG - Intronic
1062780161 10:196790-196812 CAACTGGCAAACAGAGAAAAAGG + Intronic
1062895200 10:1097793-1097815 CCTTTCCAAAAGAGAGAAAGAGG - Intronic
1063253593 10:4301852-4301874 CTATTACTAAAGAAAGAAAACGG - Intergenic
1065032778 10:21604686-21604708 CCATTCCAAAAGAGATAAATTGG + Intronic
1065354065 10:24821845-24821867 CCATTAACAAAAAGAAAAAAGGG + Intergenic
1065811640 10:29448628-29448650 GAATTGCCAAGCAGAGAAAATGG - Intergenic
1065960143 10:30727518-30727540 GAATTGCCAAGCAGAGAAAATGG + Intergenic
1066041079 10:31548487-31548509 TCATTCCAAAAGAGAGAAACAGG - Intergenic
1066695788 10:38076553-38076575 CCATTCCAAAAGAGATAAATAGG + Intergenic
1066754776 10:38700330-38700352 CCATTCCAAAAGGGAGAAATAGG + Intergenic
1067085525 10:43236018-43236040 CCAATGAGAAAGAGAGAAGAGGG + Intronic
1067783016 10:49222835-49222857 CCATACCAAAAGAGAGAAACTGG + Intergenic
1068026967 10:51658268-51658290 CTATTGACAAAGGGAGAAAGAGG + Intronic
1068221970 10:54056887-54056909 CCATTCCAAATGAGAGAAATTGG + Intronic
1068284267 10:54913878-54913900 CCATTTCAAAAGTGAGAAATTGG - Intronic
1068284950 10:54922354-54922376 CTATTCCAAAAGAGAGAAATTGG + Intronic
1068373526 10:56150222-56150244 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1068432392 10:56949532-56949554 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1068704900 10:60064360-60064382 CAATTGCCACAAAAAGAAAAGGG + Intronic
1068834306 10:61535611-61535633 CAATTGCCAGAGACAGAAATGGG - Intergenic
1069134078 10:64742376-64742398 CCATTCCAAAAGGGAGAAATAGG - Intergenic
1069513603 10:69059966-69059988 AAATTGCCACAGAAAGAAAATGG + Intergenic
1069658183 10:70105812-70105834 GCAGTGACAAAGAGGGAAAAAGG + Intronic
1070057407 10:72948949-72948971 CCAGTGACAGAGAGATAAAAGGG - Intronic
1070499661 10:77060404-77060426 CCATTCCAAAAGGGAGAATATGG - Intronic
1070502192 10:77082586-77082608 TCATTTCCAATGACAGAAAAAGG + Intronic
1071284758 10:84134215-84134237 CCATCTCAAAAGAAAGAAAAAGG + Intergenic
1071338446 10:84621173-84621195 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1071366815 10:84908344-84908366 CCAAAGCCAAGGAGAGAAAGAGG + Intergenic
1071406023 10:85333540-85333562 CCATTCCAAAAGGGAGAAATAGG + Intergenic
1071884067 10:89930526-89930548 CCATTCCAAAAGAGAGAAATAGG - Intergenic
1072295943 10:94009668-94009690 CCATTCCAAAAGGGAGAAATTGG + Intronic
1072369101 10:94745476-94745498 CCATTGCAAATGGGAGAAATTGG - Intronic
1072455519 10:95572202-95572224 ACATTGCCTAATACAGAAAATGG + Intergenic
1072738889 10:97897613-97897635 CCAGAGGCAAAGAGAGGAAAGGG + Intronic
1073491242 10:103854975-103854997 CCAATGCCAAAAAAAGAAACCGG + Intronic
1073544258 10:104335679-104335701 CCTTTGACAGAGAAAGAAAAAGG + Intronic
1073979949 10:109143110-109143132 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1074146815 10:110724187-110724209 CCACTGCCACAGAGACAAACGGG - Intronic
1074458657 10:113616919-113616941 CCTTTCCCACAGAGGGAAAAGGG + Intronic
1074845840 10:117397041-117397063 CCATTTCCAAAAAAAAAAAAAGG + Intergenic
1075076341 10:119353162-119353184 CAATTCCCAAAAAGTGAAAAGGG - Intronic
1075119976 10:119657649-119657671 CCATTCACAAAGTGACAAAAAGG - Intronic
1075131644 10:119745056-119745078 ACAATGCCAAAGATGGAAAAGGG + Intronic
1076332798 10:129683154-129683176 CCATTTTTAAAAAGAGAAAATGG + Intronic
1077034181 11:486993-487015 CCACTGCCAGAGAGAGACTACGG + Exonic
1078201798 11:9190074-9190096 CCATTCCAAATGAGAGAAATTGG - Intronic
1078374094 11:10778238-10778260 CCTTTTCCAAAGGCAGAAAAGGG - Intronic
1079138149 11:17788151-17788173 CCATGGACAAAGAGAGAAACTGG - Exonic
1079551604 11:21705684-21705706 TTATTCACAAAGAGAGAAAAAGG - Intergenic
1079872969 11:25822788-25822810 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1079962372 11:26940515-26940537 CCATTGCAAATGGGAGAAATTGG + Intergenic
1081003115 11:37699124-37699146 CAATTTCCAAAGAGATATAATGG - Intergenic
1081189167 11:40081748-40081770 CCATTTCAAAAGGGAGAAATAGG - Intergenic
1081238984 11:40680175-40680197 CCATTGCAAATGGGAGAAATTGG - Intronic
1081358537 11:42144201-42144223 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1082118942 11:48357410-48357432 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1082255359 11:50027739-50027761 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1082827085 11:57587738-57587760 CCATTCCAAATGAGAGAAATTGG - Intergenic
1083273801 11:61585851-61585873 CCAAAGCCAAACAGAGAAACAGG - Intergenic
1083770636 11:64864912-64864934 CCCTGGGGAAAGAGAGAAAAAGG + Intronic
1084498599 11:69520882-69520904 CCATTCCAAAAGGGAGAAACTGG + Intergenic
1085413420 11:76305401-76305423 TCCTTACCAAAGAAAGAAAAAGG + Intergenic
1085418472 11:76335619-76335641 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1085861903 11:80244727-80244749 CCATTCCAAATGAGAGAAATTGG - Intergenic
1086182068 11:83964172-83964194 TCAATGTCAAAGACAGAAAAGGG - Intronic
1086729224 11:90227547-90227569 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1086835172 11:91612151-91612173 GCATTTCTAAAGAAAGAAAAGGG - Intergenic
1086889044 11:92235238-92235260 GAAGTACCAAAGAGAGAAAAAGG - Intergenic
1087186372 11:95201961-95201983 GCATTTCAATAGAGAGAAAAAGG - Intronic
1087255187 11:95945382-95945404 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1087497419 11:98908534-98908556 CCATTCCAAATGAGAGAAATTGG - Intergenic
1087520593 11:99230141-99230163 CCATTCCCATTGGGAGAAAATGG - Intronic
1087550132 11:99638611-99638633 CCATTCCCAACGGGAGAAATCGG + Intronic
1087612245 11:100448446-100448468 CTATTCCAAAAGAGAGAAATTGG - Intergenic
1087756832 11:102063328-102063350 CCATTCCAAAAGGGAGAAACAGG - Intronic
1088435164 11:109804433-109804455 CCATTCCAAGTGAGAGAAAATGG + Intergenic
1088528846 11:110786287-110786309 CCATTCCAAAAGAGAGAAATTGG - Intergenic
1089103527 11:115983541-115983563 TCAGTGCAAATGAGAGAAAAAGG - Intergenic
1089380355 11:118026325-118026347 GCATTGACCAGGAGAGAAAAAGG - Intergenic
1089664802 11:120011545-120011567 CCATTACTATAGAAAGAAAATGG + Intergenic
1090153256 11:124407734-124407756 CCATTGCCAATCAAAGAAGAAGG - Intergenic
1090396456 11:126422507-126422529 CCATTGGCTAACAGAGAATAAGG - Intronic
1090727301 11:129539537-129539559 CCATTCCAAATGGGAGAAAATGG + Intergenic
1090728815 11:129551947-129551969 CCATTCCCAAAGTGAGAAATTGG - Intergenic
1091868138 12:3860599-3860621 CCATTCTGAAAGGGAGAAAAAGG - Intronic
1092361252 12:7838471-7838493 CCATTGCAAAAGGGGGAAATGGG - Intronic
1092423011 12:8348793-8348815 CTGTTACCAAAGAGATAAAAAGG + Intergenic
1093299713 12:17439321-17439343 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1093515506 12:19981665-19981687 CGATTGTCAAAGACAGAACAAGG + Intergenic
1093762799 12:22929244-22929266 CCCATGCAAAAGAAAGAAAAAGG - Intergenic
1095516931 12:43016211-43016233 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1095522664 12:43085744-43085766 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1095860956 12:46917513-46917535 CCATTGCAAAAGTGAGAAATAGG - Intergenic
1095985640 12:47997706-47997728 CCCTTGGCATAAAGAGAAAAAGG + Exonic
1096886802 12:54726606-54726628 CCATTCCAAAAGGGAGAAATCGG + Intergenic
1097501170 12:60404543-60404565 CCACTACCAAAGAGATAACATGG + Intergenic
1098614742 12:72508512-72508534 CCATTCCAAAAGGGAGAAATTGG - Intronic
1098747876 12:74263856-74263878 CCATTCCAAAAGAGACAAATAGG + Intergenic
1098830780 12:75360443-75360465 CCATTCCAAATGAGAGAAATTGG + Intronic
1099086028 12:78246925-78246947 CCATTGACAGAGAAAGAAGAGGG + Intergenic
1099469566 12:83030777-83030799 CCCTTGAAAAACAGAGAAAATGG - Exonic
1099514325 12:83577970-83577992 CCATTCACAGAGAGTGAAAAAGG - Intergenic
1099899885 12:88695103-88695125 CCCTTTCCAAATAGAGAAATTGG + Intergenic
1099996775 12:89787061-89787083 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1100007523 12:89911884-89911906 ACAAGGACAAAGAGAGAAAATGG - Intergenic
1100633773 12:96414610-96414632 CCATTGCTTTAAAGAGAAAAAGG - Intergenic
1100675767 12:96865061-96865083 ACATTTCAAATGAGAGAAAATGG - Intronic
1100937833 12:99690522-99690544 CCATTCCAAATGGGAGAAAAAGG + Intronic
1101274843 12:103188237-103188259 ACATTGCCAAAAAAATAAAAAGG - Intergenic
1102211638 12:111131639-111131661 CCATTCCGAATGAGAGAAATTGG + Intronic
1103098277 12:118149462-118149484 GCATTGCTGAAGAGAGAAATTGG - Intergenic
1103345848 12:120249758-120249780 CAACTTCCAAAGAGAGAGAAGGG + Intronic
1103357877 12:120335172-120335194 CCATTCCAAATGAGAGAAATTGG + Intergenic
1103453210 12:121044186-121044208 CCATTCCCAAGGAGAGAAGGAGG + Intergenic
1104142783 12:126004564-126004586 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1104588046 12:130063168-130063190 CCATTCCAAATGAGAGAAATTGG - Intergenic
1105064454 12:133184489-133184511 ACATGGCCAAAGAGATGAAAGGG + Intronic
1105538899 13:21297654-21297676 CCATTCCAAAAGAGAGAAAGGGG + Intergenic
1105799360 13:23889902-23889924 CCATTCCAAAAGAGAGAAAGGGG - Intergenic
1106383629 13:29264111-29264133 CCATTCCAAAAGGGAGAAATTGG + Intronic
1106455992 13:29927506-29927528 CCATTGTAAAAAAGAGAATAGGG + Intergenic
1106816567 13:33414777-33414799 ACATTATCAATGAGAGAAAATGG + Intergenic
1106877385 13:34088673-34088695 CCATTGCAAATGGGAGAAATTGG - Intergenic
1106960249 13:34989885-34989907 CCATTCCAAAAGGGAGAAATCGG + Intronic
1107105282 13:36636510-36636532 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1107434430 13:40369847-40369869 ACATGTCCAAAGACAGAAAATGG + Intergenic
1108326182 13:49333957-49333979 CCATTAACAAAGAGAAGAAAGGG - Intronic
1108599245 13:51976450-51976472 GCATTTCCTAAGAGAAAAAAGGG + Intronic
1109098360 13:58145716-58145738 CCATTCCAAATGAGAGAAATTGG - Intergenic
1109271521 13:60260914-60260936 CTCTAGCCAAAGACAGAAAAAGG - Intergenic
1109792722 13:67270533-67270555 CCAGGGCCAGAGAGAGACAATGG + Intergenic
1109871772 13:68342291-68342313 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1109906325 13:68846485-68846507 CCATTCCCAAAGGGAGAAATTGG - Intergenic
1109978211 13:69870695-69870717 CCATTCCAAAAGAGACAAATTGG + Intronic
1110635719 13:77765625-77765647 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1110896130 13:80754661-80754683 TCATTGTCAAAGACAGAAATTGG - Intergenic
1110926787 13:81164141-81164163 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1111067095 13:83107654-83107676 CCATTGCAAATGGGAGAAACTGG - Intergenic
1111318135 13:86587085-86587107 CCATTCCAAAAGAGAGAAATCGG - Intergenic
1111421718 13:88019434-88019456 CCATTCCAAATGGGAGAAAATGG - Intergenic
1111459531 13:88520709-88520731 CCATTACAAACGGGAGAAAATGG - Intergenic
1111513639 13:89298315-89298337 CCATTCCAAAAGAGAGAAATAGG - Intergenic
1111889852 13:94068661-94068683 CCATTGCAAATGGGAGAAATTGG + Intronic
1112051662 13:95649282-95649304 CCATTTCAAAAGAGAGAAATAGG + Intergenic
1112084626 13:96017065-96017087 CCGTTACCAAAGGGAGAAATCGG - Intronic
1112251420 13:97784010-97784032 CCATTTCAAAAGGGAGAAACAGG - Intergenic
1112375225 13:98833523-98833545 CCATGACCATAGAGAGGAAAAGG - Intronic
1112512321 13:100020695-100020717 CCATTCCGAAAGGGAGAAATTGG - Intergenic
1112790196 13:102994910-102994932 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1113269370 13:108655861-108655883 CCATTCCAAATGAGAGAAACTGG - Intronic
1113497453 13:110743214-110743236 CCCATTCCAAAGAGAGAAACTGG + Intergenic
1114082285 14:19211359-19211381 CCACTACAAAAGAGAGAAATTGG - Intergenic
1114170757 14:20270665-20270687 CCATTCCAAAAGGGAGAAATTGG + Intronic
1114383344 14:22231962-22231984 CCATTTCGAAAGGGAGAAATTGG + Intergenic
1114984629 14:28210862-28210884 CCATTCCCAATGGGAGAAATTGG - Intergenic
1115090318 14:29567047-29567069 CCATTCCAAATGAGAGAAATTGG + Intergenic
1115112554 14:29841086-29841108 CCATTCCAAATGAGAGAAATCGG - Intronic
1115608971 14:35034008-35034030 CCATTGCAAATGGGAGAAATCGG + Intergenic
1115916471 14:38320941-38320963 CCATTCCAAAAGAAAGAAATTGG + Intergenic
1116098824 14:40407930-40407952 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1116199236 14:41770500-41770522 CCATTCCAAAAGGGAGAAATTGG + Intronic
1116263644 14:42661338-42661360 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1116393592 14:44422306-44422328 CCATTTCAAATGAGAGAAATTGG + Intergenic
1116520413 14:45839853-45839875 CCATAGCCTAAGAAAGAAGAGGG + Intergenic
1116986143 14:51222417-51222439 CCATTCCAAATGAGAGAAATTGG + Intergenic
1116995125 14:51315455-51315477 GTATTGCCAAAGAGACAAATTGG - Intergenic
1116998382 14:51347490-51347512 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1117357939 14:54944059-54944081 CAATTTCCAAAAACAGAAAAAGG + Intronic
1117358066 14:54945429-54945451 CCATTCCATAAGTGAGAAAAGGG + Intronic
1117559602 14:56923292-56923314 CCATTCCAAAAGAGAGAAAGAGG - Intergenic
1117582481 14:57166366-57166388 CCATTTCAAAAAAAAGAAAAAGG + Intergenic
1117800777 14:59442625-59442647 CCATTTCCAAAGACAGAACTGGG + Intronic
1117802209 14:59456045-59456067 CCATTCCAAGAAAGAGAAAAGGG - Intronic
1117904953 14:60575287-60575309 GCATTTCTAAGGAGAGAAAATGG + Intergenic
1117984472 14:61374063-61374085 CCACTGCAAAAGGGAGAAATTGG + Intronic
1118431818 14:65726896-65726918 CCATTACAAATGAGAGAAATTGG + Intronic
1118956962 14:70491305-70491327 CCATTCCAAATGAGAGAAATTGG + Intergenic
1120234700 14:81876692-81876714 CCATTCCCAAAGGGAGAAATTGG - Intergenic
1120623351 14:86792664-86792686 CAATTCCCAAAGGGAGAAATTGG - Intergenic
1120817962 14:88883140-88883162 CCATTGCAAGTGAGAGAAATTGG + Intergenic
1121079388 14:91095480-91095502 CCCTTACCAAAGAAAGAACATGG - Intronic
1121852656 14:97236313-97236335 CCACAGCCAGGGAGAGAAAAAGG - Intergenic
1121881385 14:97503359-97503381 CCATTCCAAAACAGAGAAACAGG - Intergenic
1122047757 14:99035785-99035807 CCATTTCCAATGTGAGCAAACGG + Intergenic
1122555626 14:102577998-102578020 CCATTCCAAAAGGGAGAAACAGG - Intergenic
1122765410 14:104066125-104066147 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1123155677 14:106223107-106223129 TCATTGCCAAAGAAAAAAATAGG + Intergenic
1123163819 14:106306755-106306777 CCTATGCTAAAAAGAGAAAATGG + Intergenic
1123195851 14:106615895-106615917 CCATTGCAAATGGGAGAAATTGG + Intergenic
1123475057 15:20583990-20584012 TCAAAACCAAAGAGAGAAAAAGG + Intergenic
1123629045 15:22248168-22248190 CCATTCCAAATGAGAGAAATTGG - Intergenic
1123642954 15:22416374-22416396 TCAAAACCAAAGAGAGAAAAAGG - Intergenic
1123769300 15:23512588-23512610 CCATTCCAAAAGAGAGAAATGGG + Intergenic
1124005376 15:25791767-25791789 CCAAAGCAAAAGACAGAAAAGGG - Intronic
1124934699 15:34159308-34159330 ACATTGACAAAGAGATGAAAAGG + Intronic
1126185002 15:45823286-45823308 CCATTCCAAATGAGAGAAATTGG + Intergenic
1126349013 15:47725383-47725405 CCTTTTCCTAATAGAGAAAAGGG + Intronic
1126513114 15:49502511-49502533 CCATTCCAAAAGGGAGAAATCGG - Intronic
1126707101 15:51415813-51415835 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1126752271 15:51888753-51888775 CTAGTGGCTAAGAGAGAAAATGG - Intronic
1126815131 15:52446864-52446886 CCATTCCAAAAGGGAGAAATTGG - Intronic
1126951485 15:53886407-53886429 CAATGGCCAAAGCTAGAAAAAGG + Intergenic
1127236252 15:57055979-57056001 CAATTGATAAAAAGAGAAAAAGG - Intronic
1127765679 15:62183842-62183864 CCATATCCAAAGACAGAACAAGG - Intergenic
1128271888 15:66317598-66317620 TAATGGCAAAAGAGAGAAAATGG + Intronic
1128741979 15:70090085-70090107 CCACTGGCAACTAGAGAAAAGGG + Intronic
1129057570 15:72832020-72832042 CACATGCCAAAGAGAGAAAACGG - Intergenic
1129130272 15:73487455-73487477 CCATTTCAAAAGAGAAGAAATGG + Intronic
1129900964 15:79149233-79149255 CCATTGCAAATGGGAGAAATTGG + Intergenic
1130778492 15:87009848-87009870 CCATTTCAAATGAGAGAAATTGG - Intronic
1131690595 15:94823386-94823408 CCCTTCACAAAGAGAGAAACGGG + Intergenic
1131696622 15:94883411-94883433 CCATTCCAAAAGGGAGAAAATGG - Intergenic
1131730017 15:95269572-95269594 CCATTACCAGGGACAGAAAAAGG - Intergenic
1131914076 15:97243542-97243564 CCAATGCAAAAGAAAGAAAAGGG - Intergenic
1132008580 15:98253919-98253941 CGTTTCCAAAAGAGAGAAAAAGG + Intergenic
1134283525 16:12839309-12839331 CCATTCCCATAGAGAGAAAATGG - Intergenic
1134502359 16:14779258-14779280 CCATTTCCATAGAGGAAAAAAGG - Intronic
1134578203 16:15349636-15349658 CCATTTCCATAGAGGAAAAAAGG + Intergenic
1134724388 16:16407910-16407932 CCATTTCCATAGAGGAAAAAAGG - Intergenic
1134760193 16:16707752-16707774 GCATTGCCACAGAGAGACACTGG + Intergenic
1134943043 16:18303949-18303971 CCATTTCCATAGAGGAAAAAAGG + Intergenic
1134985879 16:18651453-18651475 GCATTGCCACAGAGAGACACTGG - Intergenic
1135938370 16:26799963-26799985 CCATTGTCAGGGAGAGGAAATGG + Intergenic
1136243689 16:28960630-28960652 CCATTTCAAAAGTGAGAAATTGG + Intronic
1136713336 16:32257950-32257972 CCATTGCAGAAGAGAGAAATTGG - Intergenic
1136754575 16:32671481-32671503 CCATTGCAGAAGAGAGAAATTGG + Intergenic
1136813537 16:33198883-33198905 CCATTGCAGAAGAGAGAAATTGG - Intronic
1136820013 16:33308963-33308985 CCATTGCAGAAGAGAGAAATTGG - Intergenic
1136826577 16:33365503-33365525 CCATTGCAGAAGAGAGAAATTGG - Intergenic
1136831643 16:33464274-33464296 CCATTGCAGAAGAGAGAAATTGG - Intergenic
1136997791 16:35202646-35202668 CCATTGGAGAAGAGAGAAATTGG + Intergenic
1137358578 16:47791605-47791627 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1138305743 16:55972866-55972888 CCATTGCAAAAGGGAGAAATTGG + Intergenic
1138402065 16:56754543-56754565 CCATTCCAAAAGGGAGAAATTGG + Intronic
1138997712 16:62474785-62474807 CCATTGCAAAAGGAAGAAATTGG - Intergenic
1139999161 16:71009468-71009490 CCATTTTTAAAGAGAGTAAAGGG + Intronic
1140268726 16:73443667-73443689 CCATATCCATAGAGAGAGAAAGG - Intergenic
1140414792 16:74766708-74766730 CCATAGGCAGAGGGAGAAAATGG - Intronic
1141116917 16:81316453-81316475 CCACCGCCAAAGAGCGCAAATGG - Intronic
1141975025 16:87510090-87510112 CCATTCCAAATGAGAGAAATTGG + Intergenic
1202992114 16_KI270728v1_random:21858-21880 CCATTGCAGAAGAGAGAAATTGG - Intergenic
1203056722 16_KI270728v1_random:931812-931834 CCATTGCAGAAGAGAGAAATTGG + Intergenic
1142731933 17:1865024-1865046 CCTTTGCCTAAGTGAGATAATGG + Intronic
1142888459 17:2927969-2927991 GCATTTCCACAGAGAGAAGAGGG + Intronic
1142919534 17:3172116-3172138 TCATTGCAAAAGGGAGAAATTGG - Intergenic
1143213112 17:5203900-5203922 CCATTCCAAAAGGGAGAAATAGG - Intergenic
1143288480 17:5810274-5810296 CCATTGCCCAAGTTAAAAAAGGG + Intronic
1143450091 17:7031166-7031188 CCATTCCAAAAGGGAGAAATAGG + Intergenic
1144122114 17:12165404-12165426 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1144185790 17:12793869-12793891 CCATTGCCAAAGAATGACAGAGG - Intronic
1144329835 17:14213377-14213399 CCACAGGCAAAGGGAGAAAAGGG - Intergenic
1144368735 17:14569998-14570020 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1144751709 17:17653381-17653403 CCATTCCAAAAGAGAGAAATTGG + Intergenic
1145258842 17:21342850-21342872 CCAAGGCCAGAGAGAGGAAAGGG + Intergenic
1145317782 17:21745154-21745176 CCAAGGCCAGAGAGAGGAAAGGG - Intergenic
1147059090 17:37859798-37859820 CCATTCCAAAAGAGATAAATTGG - Intergenic
1147308545 17:39579893-39579915 CCATTGCCACTGAAAGACAATGG - Intergenic
1149030778 17:52079993-52080015 CTATTTCCAAAGAGAGAAGATGG + Intronic
1149158576 17:53664065-53664087 CCATCACCAAAGGGAGAAATTGG - Intergenic
1149256306 17:54831296-54831318 GCCTTGCCAAAGAAAGTAAAGGG + Intergenic
1149449481 17:56738553-56738575 CAATGGCCAAATAGAGAGAAGGG + Intergenic
1149538047 17:57447631-57447653 CAGTTGTCAAAGAGGGAAAAGGG - Intronic
1149626257 17:58083055-58083077 CCAGTCCCAAGGAGAAAAAAGGG - Intergenic
1150323800 17:64239156-64239178 CCAATGCCCAAGACAGGAAAGGG + Intronic
1150515807 17:65808218-65808240 CCATTCCAAAAGGGAGAAATTGG - Intronic
1151375653 17:73687019-73687041 CCATTCCAAAAGTGAGAAATTGG - Intergenic
1151935554 17:77258677-77258699 GCCTTGACAAAGAGAGAAACCGG - Intergenic
1152161701 17:78672813-78672835 CCATTCCAAAAGGGAAAAAAGGG + Intergenic
1153079624 18:1207313-1207335 CTATTCCAAAAGAGAGAGAAAGG - Intergenic
1153101022 18:1469637-1469659 ACATTGCACAAGACAGAAAAGGG + Intergenic
1153349142 18:4059281-4059303 CCATGTGCAAAGAAAGAAAAGGG - Intronic
1153447237 18:5187994-5188016 CCATTCCAAAAGGGAGAAATAGG + Intronic
1156056368 18:33009409-33009431 CCAGTGTAAAAGAGAGAAAGGGG - Intronic
1156077817 18:33301720-33301742 CTATTCCAAAAGAGAGAAATTGG - Intronic
1156171867 18:34494517-34494539 CCAAAGCCAAAGAGAGAAGAGGG + Intronic
1156351352 18:36304014-36304036 AAATTGCAAAAGAAAGAAAAAGG + Intronic
1156683246 18:39616557-39616579 CCATTCCAAATGAGAGAAATTGG + Intergenic
1156858776 18:41813259-41813281 CCATTGCGAATGGGAGAAATTGG + Intergenic
1156910707 18:42408520-42408542 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1157003016 18:43549929-43549951 CCATTTCAAATGAGAGAAATTGG + Intergenic
1157842993 18:50976880-50976902 CCATTCCAAATGAGAGAAATTGG + Intronic
1158131967 18:54162022-54162044 CCATAGCCAAGAAGAGAACAGGG + Intronic
1159215648 18:65387488-65387510 CCATTCCAAATGAGAGAAATTGG - Intergenic
1159548581 18:69871226-69871248 CCATTGCCAAGGTGAAAAAGTGG + Intronic
1159569033 18:70090980-70091002 CCATTCCAAAAGAGAGAAATAGG - Intronic
1159690683 18:71483349-71483371 CCATTCCCAATGAGACGAAAGGG + Intergenic
1159718058 18:71849769-71849791 CCACTGCAAATGAGAGAAATTGG - Intergenic
1160019031 18:75166148-75166170 CCATAGGGAAAGACAGAAAAAGG - Intergenic
1160438668 18:78871359-78871381 TCATTGCAAAAGAGAGAATTAGG - Intergenic
1161430743 19:4230890-4230912 CAATTACAAAAGAGAGAACACGG + Intronic
1162217066 19:9144917-9144939 CCACTGAGAAAGAGAGAAAGAGG - Intronic
1162831855 19:13289797-13289819 CCATTGCAAAAGGGAGAAATTGG - Intronic
1162997083 19:14343037-14343059 CCATAGCCATAGGGAGAAACAGG + Intergenic
1164494731 19:28749641-28749663 CCATTCCAAATGAGAGAAATTGG + Intergenic
1164670069 19:30067388-30067410 CCTTTGGCAAGGAGAGAAGATGG + Intergenic
1166581106 19:43900788-43900810 ACATTTCCAAAGAGAAGAAAGGG + Intronic
1167281847 19:48573787-48573809 CCATTGCTACAGAGAGGACATGG - Intronic
1167403565 19:49289092-49289114 CCATTCCAAATGAGAGAAATTGG - Intergenic
1167514158 19:49913284-49913306 CACATTCCAAAGAGAGAAAATGG + Intronic
1168178556 19:54643831-54643853 CAATTGGCAATGAGAAAAAAAGG - Intronic
1168580254 19:57549600-57549622 TCATTGCCAGAGAGAGGAAGTGG + Intronic
925483064 2:4297894-4297916 CCATTCCCAAAGTGAGACAGAGG - Intergenic
925524740 2:4787424-4787446 CCATTGCAAATGAGAGAAATTGG + Intergenic
926196073 2:10764415-10764437 CAATAGCCAAGGTGAGAAAAGGG + Exonic
926456453 2:13073616-13073638 CCATTCCAAATGAGAGAAATTGG + Intergenic
926629763 2:15125713-15125735 CCATTCCAAAAGGGAGAAACTGG - Intergenic
926858205 2:17280490-17280512 CAATGGCCAAAGAGAGACCATGG - Intergenic
927086673 2:19679231-19679253 CCATTTTCAGAGAAAGAAAAAGG - Intergenic
927170792 2:20367718-20367740 CCATTTCAAAAGGGAGAAATTGG + Intergenic
927355534 2:22168739-22168761 CTATTGCAAAAGATAGAGAAAGG + Intergenic
928821515 2:35366950-35366972 CCATTGCAAATGGGAGAAATTGG - Intergenic
929664249 2:43821589-43821611 CCATTGCTTAAGGGAGAATAGGG - Intronic
930119552 2:47748808-47748830 CCATTCCAAAAGGGAGAAATGGG - Intronic
930239399 2:48920765-48920787 ACATAGCCAAAGAAACAAAAGGG + Intergenic
930254674 2:49076764-49076786 CCATTCCAAATGAGAGAAAGTGG + Intronic
930440869 2:51403736-51403758 CCATTCCAAATGAGAGAAATTGG + Intergenic
931051662 2:58422292-58422314 CAATTCTCAAAGATAGAAAAGGG - Intergenic
931496598 2:62813803-62813825 CCATTTCAAAAGAGAGAAATAGG - Intronic
932537636 2:72617005-72617027 CCATTCCAAATGAGAGAAATTGG + Intronic
932637585 2:73405400-73405422 CCAATGCCATAGAAATAAAAAGG - Intronic
932665995 2:73699270-73699292 CCATTCCAAAAGCGAGAAATTGG - Intergenic
932804598 2:74772427-74772449 ACAATGTCAAAGAAAGAAAAAGG - Intergenic
933548072 2:83740198-83740220 CCATTCCAAATGAGAGAAATTGG + Intergenic
934918570 2:98321627-98321649 CCATTCCAAATGAGAGAAATTGG - Intergenic
935090626 2:99891786-99891808 CCAGGGCCTGAGAGAGAAAATGG - Intronic
935239823 2:101168705-101168727 CCATTCCAAAAGGGAGAAATTGG - Intronic
935741323 2:106151022-106151044 CCATTCCAAAAGAGAGAAATAGG - Intronic
935951562 2:108334459-108334481 GCATGCCAAAAGAGAGAAAAGGG + Intergenic
936728864 2:115357324-115357346 CCATTCCAAATGAGAGAAATTGG + Intronic
936903231 2:117507729-117507751 CCAATGCAAAACTGAGAAAATGG + Intergenic
936905811 2:117534456-117534478 CCATTCCAAAAGAGAGAAATTGG - Intergenic
937380832 2:121374776-121374798 CCATTCCAAAAGGGAGAAATTGG - Intronic
937510418 2:122589011-122589033 CCATTGCAAAAGGGAGCAATTGG - Intergenic
937660979 2:124429521-124429543 CATTTCCCAGAGAGAGAAAAGGG - Intronic
937942437 2:127296437-127296459 CCATTCCAAAAGGGAGAAATGGG - Intergenic
938086459 2:128405231-128405253 CCATTTCCTAATACAGAAAATGG + Intergenic
938382156 2:130842817-130842839 TGATTGCCAAAGACAGTAAAGGG + Intronic
938494303 2:131785245-131785267 CCATTATAAAAGAGAGAAATTGG + Intergenic
938613158 2:132969968-132969990 ACATTGAGAAAGAGAGAAAATGG + Intronic
939242005 2:139573127-139573149 CCATTCCAAAAGGGAGAAATTGG - Intergenic
939278957 2:140038282-140038304 CCATTCCAAATGAGAGAAATTGG + Intergenic
939361325 2:141176022-141176044 CCACTCCAAAAGAGAGAAATTGG - Intronic
939826677 2:147023908-147023930 CCATTCCAAAAGGGAGAAATTGG + Intergenic
939827150 2:147028465-147028487 CCATTCCAAAAGGGAGAAATTGG + Intergenic
940451492 2:153843759-153843781 CCATTCCCAAAGTGAGAAATTGG + Intergenic
940499714 2:154478516-154478538 CCATTCCAAAAGGGAGAAATTGG - Intergenic
941581937 2:167308704-167308726 CCATTGCCAACTAAAGAAAAGGG - Intergenic
942770085 2:179506653-179506675 CCAGTGCACAAAAGAGAAAAAGG - Intronic
942783379 2:179672223-179672245 CTATTCCAAAAGAGAGAAATAGG - Intronic
943153881 2:184149000-184149022 CCATTTCAAAAGGGAGAAATTGG + Intergenic
943491069 2:188557378-188557400 CCATTCCAAAAGGGAGAAATTGG + Intronic
943757110 2:191568332-191568354 CCATTGACATGGAAAGAAAAGGG + Intergenic
943998149 2:194797587-194797609 CCATTTCCAATGGGAGAAATTGG - Intergenic
944379515 2:199092071-199092093 CCATTCCAAAAGGGAGAAATAGG + Intergenic
944834962 2:203570233-203570255 CATTTGCCAAAGTGAGAAGATGG - Intergenic
945330653 2:208536197-208536219 CCATTCCCAATGGGAGAAATTGG + Intronic
945608863 2:211973204-211973226 CCATTTCAAAAAAGAAAAAAAGG - Intronic
945655487 2:212617570-212617592 CCATGACAAAAAAGAGAAAACGG + Intergenic
946147937 2:217744820-217744842 CCCTTGCTAAAAAGAGAAAAAGG + Intronic
946574198 2:221056874-221056896 CCATTCCAAATGAGAGAAATTGG + Intergenic
946575481 2:221071301-221071323 CCATTTCAAATGAGAGAAATTGG + Intergenic
947197619 2:227584329-227584351 CCATTCCAAAAGAGAGAAACTGG - Intergenic
947743064 2:232493728-232493750 CCAGTGCCACAGACAGAAAATGG - Intergenic
947903861 2:233745383-233745405 CCAGTGTCAAAAAGAGAATAAGG - Intronic
947905263 2:233756741-233756763 CCAGTGTCAAAAAGAGAATAAGG - Intronic
947951554 2:234152311-234152333 CCATTCCAAATGAGAGAAATTGG + Intergenic
948209960 2:236185555-236185577 CCATTCCAAAAGGGAGAAATTGG - Intergenic
948520270 2:238532084-238532106 CCATTCCAAATGAGAGAAATTGG - Intergenic
948551841 2:238778112-238778134 CCACTGTCTGAGAGAGAAAAGGG - Intergenic
1168803396 20:658657-658679 CCATTCCAAAAGGGAGAAATAGG - Intronic
1169130167 20:3162637-3162659 CCTTTCCCAAAGAAATAAAACGG - Exonic
1169778577 20:9283598-9283620 CCCCTGCCCAGGAGAGAAAAGGG - Intronic
1170538574 20:17365712-17365734 CCATTCCCAAAGGGAGAAATAGG + Intronic
1170902204 20:20475178-20475200 CCAATGCCAACCACAGAAAAGGG - Intronic
1171001802 20:21422831-21422853 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1171141575 20:22748179-22748201 GCATTTCCAAAAATAGAAAAGGG - Intergenic
1173614606 20:44394610-44394632 CTGTTACCAAAGAGAGATAAAGG - Intronic
1175255960 20:57647365-57647387 GCATAGCCACAGGGAGAAAATGG + Intergenic
1175457181 20:59124256-59124278 CCATTGCCAAAGAAAAATCATGG + Intergenic
1175515135 20:59564541-59564563 CCACAGCCACGGAGAGAAAAGGG + Intergenic
1176690554 21:9903517-9903539 CCATTTCAAAAGGGAGAAATTGG + Intergenic
1176696068 21:9978995-9979017 CCATTGCAAATGGGAGAAATTGG - Intergenic
1176883841 21:14230262-14230284 CCATTCCAAATGAGAGAAATTGG - Intergenic
1176938334 21:14893389-14893411 TTATGGTCAAAGAGAGAAAAGGG + Intergenic
1177188563 21:17824432-17824454 CCATTGCAAAAGGGAGAAATTGG + Intergenic
1177258155 21:18692686-18692708 CCATTCCAAATGAGAGAAATTGG + Intergenic
1177312369 21:19413689-19413711 CCATTTCAAAAGGGAGAAATTGG - Intergenic
1177525795 21:22288191-22288213 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1177599307 21:23289633-23289655 CCATTCCAAATGAGAGAAATTGG - Intergenic
1178218181 21:30624975-30624997 CCATTTCAAAAGGGAGAAATTGG + Intergenic
1178903287 21:36615044-36615066 CCATTCCCAAAGGGAAAAATGGG + Intergenic
1179557934 21:42192503-42192525 CCACTTCCAAAAAGAGAAACTGG - Intergenic
1180306232 22:11128250-11128272 CCATTCCAAAAGGGAGAAATAGG + Intergenic
1180498491 22:15911311-15911333 CCACTACAAAAGAGAGAAATTGG + Intergenic
1180544751 22:16490433-16490455 CCATTCCAAAAGGGAGAAATAGG + Intergenic
1181285952 22:21752676-21752698 CCATGGCCAAGGAGAGACATGGG + Intergenic
1181387585 22:22557442-22557464 CCATTTCCAGAGAGAAAACAGGG + Exonic
1181425117 22:22831042-22831064 AAATTTCAAAAGAGAGAAAAAGG + Intronic
1181450703 22:23018147-23018169 CCATTTCAAAAAAAAGAAAAAGG + Intergenic
1182640750 22:31765294-31765316 CCATTTCAAAAAAAAGAAAAAGG - Intronic
1182967441 22:34535439-34535461 CCATTCCAAAAGGGAGAAATGGG + Intergenic
1184327795 22:43803881-43803903 CCATCTCTAAAGAAAGAAAAAGG - Intronic
1184435765 22:44474226-44474248 CCATTCCAAAAGAGAGAAATAGG - Intergenic
1184534657 22:45078137-45078159 CCATTGGCACAGAGAGAGGATGG + Intergenic
1184623660 22:45704146-45704168 GTACTGGCAAAGAGAGAAAATGG - Intronic
949372963 3:3354910-3354932 CCATTTCAAAAGTGAGAAACAGG - Intergenic
949665400 3:6332473-6332495 TCATTGCCAATGGGAGAAATTGG - Intergenic
949692903 3:6661654-6661676 CCATTCCCAATGGGAGAAATTGG + Intergenic
949694646 3:6680662-6680684 CTGTGGCCAGAGAGAGAAAATGG + Intergenic
949821590 3:8121882-8121904 GTATCTCCAAAGAGAGAAAAGGG + Intergenic
951133444 3:19075467-19075489 CCATTCCAAAAGAAAGAAATTGG - Intergenic
951396446 3:22173514-22173536 TTATTGTCAAGGAGAGAAAATGG - Intronic
951780076 3:26353037-26353059 CCATTGCCAGAGAGAAAACAAGG + Intergenic
951937109 3:28033798-28033820 CCATTCCAAAAGGGAGAAATTGG - Intergenic
952215366 3:31272636-31272658 TCAAGACCAAAGAGAGAAAATGG - Intergenic
952256503 3:31699962-31699984 CAACTGCCAAGAAGAGAAAAGGG + Intronic
952440500 3:33322944-33322966 CTATTGCTAAAGACAGCAAAGGG - Intronic
952638635 3:35563317-35563339 CCATTCCGAAATTGAGAAAAAGG - Intergenic
952642551 3:35614758-35614780 CCATTTCCAAAGTGGAAAAACGG - Intergenic
952919459 3:38274977-38274999 CCATTGCCACAGTGACAGAATGG + Exonic
953094904 3:39765903-39765925 CCATTCCAAAAGGGAGAAATTGG + Intergenic
955355838 3:58231952-58231974 CCACTGCTAAAGACAGGAAAAGG - Intergenic
955551126 3:60086592-60086614 CCATTCCAAAAGGGAGAAATTGG + Intronic
955586192 3:60480582-60480604 CCATTACAAATGAGAGAAATTGG + Intronic
955833160 3:63026189-63026211 CCATTGCAAAAGGGAGAAATTGG + Intergenic
956144330 3:66177093-66177115 CCAATGCCAAAGGGAGACAGAGG - Intronic
956572457 3:70712223-70712245 CCATTCCAAAAGGGAGAAATTGG + Intergenic
957041521 3:75339246-75339268 TCATTGCCAAGCAGAGAAATTGG - Intergenic
957113612 3:75995928-75995950 CCATTCCAAAAGGGAGAAATTGG - Intronic
957148642 3:76457279-76457301 CCATTCCAAATGAGAGAAATTGG + Intronic
957443968 3:80291417-80291439 CCATTCCAAAAGGGAGAAATTGG + Intergenic
957495191 3:80982846-80982868 CCATTCCCAAAGGGAGAAACTGG - Intergenic
957716582 3:83936090-83936112 CCATTCCAAGAGGGAGAAAAAGG - Intergenic
957743295 3:84303536-84303558 CCATTACCAAAGTGAGGAAAAGG + Intergenic
957746235 3:84347077-84347099 CCTTTCCCAAAGGAAGAAAATGG + Intergenic
958553228 3:95643053-95643075 CCATTCCAAATGGGAGAAAATGG + Intergenic
958638989 3:96780288-96780310 CCATTCCAAATGAGAGAAATTGG - Intergenic
958781060 3:98542974-98542996 CCATTCCAAAAGAGAGAAGCAGG - Intronic
958893367 3:99804665-99804687 CCATTCCAAAAGGGAGAAATTGG + Intergenic
959183114 3:103007463-103007485 CCATTCCAAAAGAAAGAAATTGG + Intergenic
959196479 3:103188854-103188876 CCATTCCAAAAGGGAGAAATAGG - Intergenic
959451198 3:106503794-106503816 ACAATGCAAAAGAGAGACAATGG - Intergenic
959803645 3:110525390-110525412 CCATTCCAAATGTGAGAAAATGG - Intergenic
959835162 3:110910144-110910166 CCTTTGCCCAAGAGATGAAATGG + Intergenic
959838946 3:110951706-110951728 CCATTCCAAAAGGGAGAAATAGG - Intergenic
959977748 3:112481050-112481072 CCATTCCAAAAGGGAGAAATAGG + Intronic
960323964 3:116272067-116272089 CCAAAGACAAAGAGATAAAAAGG - Intronic
960581544 3:119283180-119283202 CCATTCCAAAAGGGAGAAATTGG - Intergenic
960724651 3:120658301-120658323 CCATTTCAAAAGGGAGAAATTGG + Intronic
960838003 3:121926996-121927018 CCATTCCAAAAGGGAGAAACTGG - Intronic
961046229 3:123710067-123710089 TCATTGCCAAGCAGAGAAATGGG - Intronic
961257874 3:125572197-125572219 CCATTCCAAATGGGAGAAAAAGG - Intronic
962224081 3:133590289-133590311 CCATTTTCAAAGACAGAATAAGG - Intergenic
962240513 3:133747383-133747405 CCATGGGCCAAGAGGGAAAATGG + Intronic
962545657 3:136431630-136431652 CCATTACCAGAGAAACAAAAAGG - Intronic
962607898 3:137047705-137047727 TCATCAGCAAAGAGAGAAAATGG - Intergenic
963022597 3:140886513-140886535 CCATTCCAAATGAGAGAAATTGG - Intergenic
963494766 3:146045219-146045241 CCATTCCAAAAGGGAGAAATTGG + Intergenic
963501020 3:146126608-146126630 CGATGGCAAAAGACAGAAAAGGG + Intronic
963511780 3:146256420-146256442 CCATTCCAAAAGGGAGAAATTGG + Intergenic
963834796 3:150047467-150047489 CCATTTGCACGGAGAGAAAAGGG - Intronic
964150435 3:153518220-153518242 CCATTACAAATGAGAGAAATTGG + Intergenic
964248799 3:154685738-154685760 TCCTTGCAAAACAGAGAAAAGGG - Intergenic
964271150 3:154958153-154958175 CCATTCCAAAAGGGAGAAATAGG + Intergenic
965057724 3:163743944-163743966 CCATTTCAAATGAGAGAAATTGG + Intergenic
965349711 3:167597798-167597820 CCATTCCAAAAGGGAGAAATTGG - Intronic
965397198 3:168174025-168174047 CCATTCCAAAAGGGAGAAATTGG + Intergenic
965416747 3:168404667-168404689 CCATATCCTAAGTGAGAAAATGG + Intergenic
965461365 3:168968317-168968339 CCATTCCAAAAGAAAAAAAAAGG + Intergenic
965676203 3:171199560-171199582 CTATTTCCAAATACAGAAAAAGG - Intronic
965764282 3:172113780-172113802 ATACTGCCAAAGAGGGAAAAAGG - Intronic
965864383 3:173187016-173187038 TCATTGCCAATGTGAAAAAATGG - Intergenic
965891494 3:173519638-173519660 CCATTCCAAAAGAGAGAAATTGG - Intronic
966074327 3:175918901-175918923 CCATTCCAAAACAGAGAAATTGG + Intergenic
966550476 3:181199368-181199390 CCATCCCCAAAGTGAGAAATTGG + Intergenic
967422270 3:189286709-189286731 CTCTTGTCAAAGAGAGAATAAGG + Intronic
967556035 3:190860500-190860522 CACTTGCCAAATAGTGAAAATGG - Intronic
967577280 3:191108372-191108394 CCATTCCAAAAGACAGAAATTGG - Intergenic
967622474 3:191650443-191650465 CCATTCCAAAAGAAAGAAATTGG + Intergenic
967844983 3:194036005-194036027 CAAAAGGCAAAGAGAGAAAAGGG + Intergenic
967947420 3:194814986-194815008 GGATGGCCAAAGAGAGAAAGAGG + Intergenic
968090846 3:195897311-195897333 CCAGGGCCCAAGAAAGAAAAGGG + Intronic
968265644 3:197360936-197360958 CCATTCCAAATGAGAGAAATTGG - Intergenic
969080741 4:4616076-4616098 CCAATGCCAAAGAGAAGAAGTGG - Intergenic
970317292 4:14841619-14841641 CCATTTCAAAAGGGAGAAACTGG + Intergenic
970461346 4:16277646-16277668 CCATTCCAAAAGGGAGAAATTGG - Intergenic
970571081 4:17383676-17383698 CCATTCCTAAAGGGAGAAATAGG - Intergenic
970707007 4:18816351-18816373 CTATTCCAAAAGAGAGAAATTGG - Intergenic
971117464 4:23664725-23664747 CCATTCCAAAAGGGAGAAATAGG - Intergenic
971139720 4:23911071-23911093 CCACAGCCTAACAGAGAAAATGG + Intergenic
971723740 4:30281430-30281452 GAATTGAAAAAGAGAGAAAAGGG - Intergenic
971748129 4:30611397-30611419 CCATTCCAAAAGGGAGAAATTGG - Intergenic
971806057 4:31358599-31358621 CCATTCCAAAAGGGAGAAATAGG - Intergenic
971855989 4:32044243-32044265 CCAAGGCCAAAGAGCAAAAATGG - Intergenic
971911082 4:32798511-32798533 CCAGGGGCAAAGAGAGAAGATGG + Intergenic
971969543 4:33604154-33604176 CCATTCCAAAAGAAAGAAATTGG + Intergenic
972057207 4:34818172-34818194 CCATTGCCAAAGACTGAAGCTGG + Intergenic
972069554 4:34998946-34998968 CCATTGTCAAAAAGGAAAAAGGG - Intergenic
972090827 4:35281101-35281123 ACATTATCAAAGAGAGCAAAAGG - Intergenic
972164462 4:36265552-36265574 GAACTGCCAGAGAGAGAAAAGGG - Intergenic
972251213 4:37304583-37304605 CCATTCCAAAAGGGAGAAATTGG + Intronic
972367881 4:38393063-38393085 CCATTCCAAAAGAGAGAAAGGGG - Intergenic
973015665 4:45134455-45134477 CCATTCCAAATGAGAGAAATTGG + Intergenic
973780311 4:54282846-54282868 CCATTCCCAAAGGGAGAAATCGG + Intronic
974101567 4:57422882-57422904 CCATTCCAAATGGGAGAAAATGG - Intergenic
974145194 4:57937704-57937726 CCATTCCAAATGAGAGAAATTGG - Intergenic
974154618 4:58055316-58055338 CCATTCCAAAAGGGAGAAATTGG + Intergenic
974664037 4:64935323-64935345 TCATTGCAAAAGGGAGAAATAGG + Intergenic
975200971 4:71589189-71589211 CCAAATCTAAAGAGAGAAAATGG - Intergenic
975223989 4:71848073-71848095 CCATAGCCAATGAGATATAATGG + Intergenic
975307425 4:72865855-72865877 CCATTCTAAAAGAGAGAAATTGG - Intergenic
975524879 4:75338049-75338071 CCATTTCCAAGATGAGAAAACGG + Intergenic
976152309 4:82104704-82104726 CCTTTGCCAAAAAGAGAGGATGG - Intergenic
976156506 4:82150517-82150539 GCTTTGAAAAAGAGAGAAAATGG - Intergenic
976259803 4:83135047-83135069 CCATTGCAAATGGGAGAAATTGG + Intronic
976952551 4:90850628-90850650 CCATTCCAAATGAGAGAAATTGG - Intronic
976953087 4:90857886-90857908 CTCTTGCCATAGGGAGAAAATGG + Intronic
977543041 4:98341257-98341279 CTATTGTCAAAGAAATAAAAGGG - Intronic
977874220 4:102129869-102129891 CCATTCCAAAAGGGAGAAATTGG - Intergenic
977950546 4:102965852-102965874 CCATTCCAAAAGGGAGAAATAGG + Intronic
978044310 4:104107322-104107344 CCATTTCAAAAGAGAGAAATTGG - Intergenic
978526949 4:109677208-109677230 CCACTGCAAAAGGGAGAAATAGG - Intronic
978774269 4:112490325-112490347 CCATTCCAAATGAGAGAAATTGG + Intergenic
979209635 4:118083962-118083984 CCATTGCCAATGAGAACAATAGG + Intronic
979507589 4:121515346-121515368 CCATTCCAAAAGGGAGAAATTGG - Intergenic
979573684 4:122260411-122260433 CCAATACCAAATAGAAAAAATGG + Intronic
979881860 4:125970348-125970370 TCATTCCAAAAGAGAGAAACTGG + Intergenic
979910464 4:126359640-126359662 CTATTGACGAAGGGAGAAAAAGG - Intergenic
979969356 4:127114790-127114812 CCGTTCCAAAAGAGAGAAATTGG - Intergenic
980264083 4:130492904-130492926 CCATTCCCAAAGGGAGAAATTGG - Intergenic
980353953 4:131721440-131721462 CCATTTCAAAAGGGAGAAATTGG + Intergenic
980368684 4:131839223-131839245 CCATTGCAAATGGGAGAAATTGG - Intergenic
980448519 4:132942656-132942678 CCATTCCAAAAGGGAGAAATTGG + Intergenic
980596607 4:134962850-134962872 CCATTCCAAATGAGAGAAATTGG - Intergenic
980741134 4:136950538-136950560 CTATTGTCAAAGAGAGAGCATGG - Intergenic
981132648 4:141175094-141175116 CCAGTACCAAACTGAGAAAAAGG + Intronic
981356794 4:143798719-143798741 CCATTCCAAAAGGGAGAAATTGG + Intergenic
981368324 4:143929316-143929338 CCATTCCAAAAGGGAGAAATTGG + Intergenic
981378121 4:144039601-144039623 CCATTCCAAAAGGGAGAAATTGG + Intergenic
981872998 4:149508556-149508578 CCATTGCAAATGGGAGAAATTGG - Intergenic
982171746 4:152668595-152668617 GCATTGCCAGAGAGAAAAACTGG + Intronic
982286988 4:153746191-153746213 CCATTCCAAAAGGGAGAAATAGG + Intronic
982546876 4:156744855-156744877 GCATTTTCAAAGAGACAAAAAGG + Intergenic
982834618 4:160108851-160108873 CCATTCCAAAAGAGTGAAATTGG + Intergenic
983015615 4:162608420-162608442 TCATTGCAAAAGGGAGAAATTGG - Intergenic
983236627 4:165187636-165187658 CCATTCCAAATGAGAGAAATTGG + Intronic
983361506 4:166729109-166729131 CTATTTCCTAACAGAGAAAACGG + Intergenic
983475153 4:168204085-168204107 CCATTCCAAAAGGGAGAAATTGG - Intergenic
983508149 4:168577804-168577826 CCTTGGCCAAAGAAAGAAGAAGG + Intronic
983643840 4:169969808-169969830 GCATTGCCAAAGTGTGAAAATGG + Intergenic
983769913 4:171536332-171536354 CTATTGCAAAAGGGAGAAACAGG - Intergenic
984404970 4:179316940-179316962 ACATTCCCAAAGAGAGCACAAGG - Intergenic
984431953 4:179661375-179661397 CCATTCCAAAAGGGAGAAATAGG - Intergenic
985329708 4:188817822-188817844 GAATTGCAAAACAGAGAAAAAGG + Intergenic
986022319 5:3816074-3816096 CCATTGCCAAAGTCACAAATAGG - Intergenic
986081038 5:4394612-4394634 CCATTTCAAATGAGAGAAATTGG + Intergenic
986250527 5:6053682-6053704 CCATTGCAAAAGGGAGAAATAGG - Intergenic
986507724 5:8470267-8470289 CCATTTCAAATGAGAGAAATTGG + Intergenic
986672634 5:10156707-10156729 CCATTCCAAAAGGGAGAAATAGG + Intergenic
986869761 5:12032183-12032205 CCATTACAAAAGGGAGAAATTGG - Intergenic
986880305 5:12161759-12161781 CCATTCCGAAAGTGATAAAAAGG - Intergenic
986900268 5:12422266-12422288 CCATTCCAAATGAGAGAAATTGG - Intergenic
987292091 5:16518942-16518964 ACTTTGCCAAAGAGAAATAAGGG + Intronic
987311209 5:16682812-16682834 CCCTTGCCAACTATAGAAAAAGG - Intronic
987478988 5:18428955-18428977 CCATTCCAAATGAGAGAAATTGG - Intergenic
987610754 5:20199431-20199453 CCATTCCAAATGAGAGAAATTGG - Intronic
987737733 5:21867619-21867641 CCATTCCAAATGAGAGAAATTGG - Intronic
987751542 5:22045321-22045343 ACATTCCCAAAGAGTGTAAAGGG - Intronic
987891083 5:23879399-23879421 CCATTCCAAAAGGGAGAAATTGG - Intergenic
988052505 5:26049235-26049257 ACATGGCCAGAGAGAGGAAAGGG + Intergenic
988368169 5:30329899-30329921 CAATTTCCAAACAGAGGAAAGGG + Intergenic
989162707 5:38406973-38406995 CCATTCCCATACAGAGAAAGGGG + Exonic
989484703 5:41976470-41976492 CCATTCCAAAAGGGAGAAATTGG + Intergenic
990143453 5:52731626-52731648 CCATTCCAAAAGGGAGAAATTGG - Intergenic
990406274 5:55494038-55494060 CCAACTCCAAAGAAAGAAAAAGG + Intronic
990560103 5:56975173-56975195 ACATGGCCAAACTGAGAAAACGG + Intergenic
990619231 5:57541896-57541918 CCTTTTCCAAAGAGAGTAATCGG - Intergenic
990939693 5:61189081-61189103 CCATTCCAAAAGGGAGAAATTGG - Intergenic
991536004 5:67669793-67669815 CCATTCCAAATGAGAGAAAATGG - Intergenic
992020783 5:72621603-72621625 CCATTGCCACAGAGAGCAAAAGG - Intergenic
992215104 5:74518210-74518232 TCAGTGCCAAAGGGAGAGAAGGG - Intergenic
992279779 5:75162372-75162394 CCATTCCAAATGAGAGAAATTGG - Intronic
992465959 5:77004824-77004846 CCAGTGAAAAAGAGAGAGAAGGG - Intergenic
992466376 5:77009704-77009726 TCATTTTCAAAGAGAAAAAAAGG - Intergenic
992558756 5:77929458-77929480 TCATTGCCAGAGAGATAGAATGG - Intergenic
992931352 5:81650034-81650056 CCATTTCTAAAAAGAGAAAATGG + Intronic
993016945 5:82544920-82544942 CCATTCCAAAAGGGAGAAATTGG - Intergenic
993253063 5:85553218-85553240 CCATTCCAAAAGGGAGAAATTGG + Intergenic
993524145 5:88943754-88943776 CTTTTGCCACAGAAAGAAAAGGG + Intergenic
993742013 5:91553310-91553332 CCATTCCAAAAGAGAGAAATTGG - Intergenic
994057773 5:95438436-95438458 CAAGTGGAAAAGAGAGAAAAAGG + Intronic
994141938 5:96351308-96351330 CTATGGCCAAAGAGATATAATGG + Intergenic
994283775 5:97938741-97938763 CCATTTCAAAAGAGAAAAATTGG - Intergenic
994443168 5:99836308-99836330 CCCTTCCAAAAGAGAGAAATTGG - Intergenic
994464725 5:100112019-100112041 CCATTGCAAATGGCAGAAAATGG + Intergenic
994519857 5:100819719-100819741 CCATTTGTGAAGAGAGAAAATGG + Intronic
994519859 5:100819748-100819770 CCATTTATAAAGAGAGAAAGTGG + Intronic
995761451 5:115566104-115566126 CCATTCCAAAAGGGAGAAATAGG - Intergenic
995922670 5:117332410-117332432 CCTTTGCCAAAACAAGAAAATGG - Intergenic
996026936 5:118657120-118657142 CCATTCCAAAAGGGAGAAACTGG + Intergenic
996480060 5:123965819-123965841 CCTTTTCTATAGAGAGAAAAAGG - Intergenic
996480833 5:123973409-123973431 CCATTTCAAAAGGGAGAAATTGG + Intergenic
996512989 5:124338278-124338300 CCATTCCAAAAGGGAGAAAGAGG + Intergenic
996611283 5:125383013-125383035 CCATTCCCAAAAGGAGAAATTGG - Intergenic
997283901 5:132664924-132664946 ACATTGCCAAAGACAGAGGAAGG + Intergenic
997828359 5:137127686-137127708 CCATCCCAAAAGAGAGAAATAGG - Intronic
998192578 5:140039844-140039866 CCATTGCAAAATAGGGAAACTGG - Intronic
998655647 5:144176308-144176330 TTATTGGCAAAGAAAGAAAAAGG + Intronic
998955681 5:147435903-147435925 CCATTGCCAAGGCCAGAAGAGGG + Intronic
999986144 5:157007356-157007378 CCATTCCAAAAGAGAGAAATTGG + Intergenic
1000141169 5:158404601-158404623 CCATTCCAAATGAGAGAAACTGG - Intergenic
1000225846 5:159261323-159261345 AAATGGCCAGAGAGAGAAAAGGG + Intergenic
1000253003 5:159513067-159513089 TCTTTGATAAAGAGAGAAAAAGG - Intergenic
1000948038 5:167446392-167446414 TCAATGCCAAACAGAGAAAATGG - Intronic
1001058041 5:168465365-168465387 CCCTTGCCAAAGGGGGAGAAGGG + Intronic
1002013139 5:176300775-176300797 CCAGTGCCACAGAAATAAAAAGG + Intronic
1002214697 5:177621973-177621995 CCAGTGCCACAGAAATAAAAAGG - Intergenic
1003058387 6:2842772-2842794 CCATTCCCAAAGGGAGAAGCAGG + Intergenic
1003838116 6:10093046-10093068 CCATTCCAAAAGGGAGAAATTGG + Intronic
1003979624 6:11377538-11377560 CCATTCCAAAAGGGAGAAATTGG - Intronic
1004087806 6:12468547-12468569 CCTCTGCCAAAGAGAGATTATGG + Intergenic
1004453428 6:15769034-15769056 CCATTCCAAAAGACAGAACAAGG - Intergenic
1004755697 6:18608174-18608196 CCATTTCAAAAGGGAGAAATGGG + Intergenic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1005229519 6:23684325-23684347 CCATTCCAAAAGGGAGAAATAGG + Intergenic
1005716151 6:28550251-28550273 CCATTCCAAAAGGGAGAAATAGG - Intergenic
1005908103 6:30283509-30283531 CCATTCCAAAAGTGAGAAATTGG + Intergenic
1007878480 6:45134650-45134672 TCATTTCCAAAGAGAGAGACAGG + Intronic
1008431466 6:51422582-51422604 CTATTTCAAAAGAAAGAAAAAGG + Intergenic
1008848123 6:55993197-55993219 CCATTCCAAAAGAGAGAAATTGG + Intergenic
1008908675 6:56708962-56708984 ACATATCCAAAAAGAGAAAAAGG - Intronic
1009618177 6:66038044-66038066 CCATTCCTAAAGGGAGAAATAGG + Intergenic
1009723396 6:67505876-67505898 CCATTCCAAATGGGAGAAAATGG + Intergenic
1009826161 6:68867851-68867873 CCATTGCAAAAGGGAGAAATTGG - Intronic
1010389620 6:75321842-75321864 ACATATCTAAAGAGAGAAAAAGG + Intronic
1010517325 6:76789515-76789537 CCATTCCAAAAGAGAGAAATTGG + Intergenic
1010628883 6:78173932-78173954 CCACTATCTAAGAGAGAAAATGG + Intergenic
1010735782 6:79442669-79442691 CCATTCCAAATGAGAGAAATTGG + Intergenic
1010978241 6:82340853-82340875 CCATTCCAAAAAGGAGAAAATGG + Intergenic
1011135224 6:84092871-84092893 CCATTCCAAAAAGGAGAAAATGG + Intergenic
1011294008 6:85807790-85807812 CCATTCCAAATGAGAGAAATTGG + Intergenic
1011950530 6:92958984-92959006 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1012112831 6:95259215-95259237 CCTTTGCCAACGAGGGCAAATGG + Intergenic
1012127392 6:95448086-95448108 CAATTGTGAAAGAGACAAAATGG - Intergenic
1012337192 6:98075375-98075397 CTATTGCCAAAGAGATAGAAAGG + Intergenic
1012597283 6:101054991-101055013 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1012858503 6:104530551-104530573 CCATTGCCCTAAAGAGAAATAGG - Intergenic
1013214482 6:108015148-108015170 CCATTCCAAATGAGAGAAATTGG + Intergenic
1013587569 6:111593238-111593260 CAAATACCAGAGAGAGAAAAGGG + Intronic
1013624349 6:111921651-111921673 CCATTGACCAAGAGAGTAAAAGG - Intergenic
1013688165 6:112609787-112609809 CCATTTCAAATGAGAGAAATTGG - Intergenic
1013823637 6:114184895-114184917 CCATTTCAAAAGACAGAAATGGG - Intronic
1013910776 6:115273148-115273170 CCATTCCAAATGAGAGAAATTGG - Intergenic
1014036304 6:116770155-116770177 CAATTGCCAAGGAGAAAACAAGG - Intergenic
1014075534 6:117230578-117230600 CTATTGCAAAAGGGAGAAATTGG + Intergenic
1014509955 6:122308446-122308468 CCATTCCAAAAGGGAGAAATCGG - Intergenic
1014537983 6:122639297-122639319 CCCTTGTCAAGGAGAGTAAAGGG + Intronic
1014783932 6:125596676-125596698 TCATTGCCAAGGACAGAAATAGG + Intergenic
1015045105 6:128767706-128767728 CCATTCCAAATGAGAGAAATTGG + Intergenic
1015172767 6:130272241-130272263 GCATTTCAAAACAGAGAAAAAGG - Intronic
1015296128 6:131595276-131595298 GCATTGAAAATGAGAGAAAAGGG - Intronic
1015662235 6:135588800-135588822 CCATTCCAAAAGGGAGAAATCGG + Intergenic
1015762829 6:136683449-136683471 CCATGGCCATAGCAAGAAAAAGG + Intronic
1015807365 6:137124339-137124361 ACATTGCCACTGAAAGAAAAGGG - Intergenic
1016301356 6:142635415-142635437 CCATTCTCAAAGAGAGAAATTGG + Intergenic
1016577745 6:145589218-145589240 CCATTGCCAAAGGGTGTGAATGG + Intronic
1016592953 6:145766376-145766398 CCATTCCAAATGAGAGAAACTGG - Intergenic
1016632633 6:146250027-146250049 CCATTCCAAATGAGAGAAATTGG - Intronic
1016926965 6:149360844-149360866 CCATTCCAAAAGGGAGAAATTGG + Intronic
1017133726 6:151130041-151130063 CCATTCCCGATGAGAGAAATTGG - Intergenic
1017401727 6:154072076-154072098 CTATTGCCAAAGAAGGAGAAGGG - Intronic
1017576907 6:155815649-155815671 CCATTCCAAAAGGGAGAAATGGG + Intergenic
1017931403 6:158958815-158958837 CTATTTCAAAAGAGAGAAATAGG + Intergenic
1017938007 6:159024468-159024490 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1018032722 6:159855237-159855259 TCATTGTCAAAAACAGAAAAAGG - Intergenic
1018075261 6:160206943-160206965 CCATTCCAAATGAGAGAAATTGG + Intronic
1018162747 6:161063356-161063378 CCATAAGCAGAGAGAGAAAAAGG - Intronic
1018275475 6:162125683-162125705 CCATGGCCAAAGTCATAAAAGGG + Intronic
1018477637 6:164159090-164159112 CCATTCCAAATGAGAGAAATTGG + Intergenic
1018510607 6:164520429-164520451 CCATTTCAAAAGACAGAAATTGG - Intergenic
1019107268 6:169678405-169678427 CCATTTCCAAAGGGAGAAATTGG - Intronic
1019824650 7:3273806-3273828 CCATTGGAAAACTGAGAAAAGGG - Intergenic
1020453610 7:8347155-8347177 CCATTCCAAATGAGAGAAATTGG - Intergenic
1020515508 7:9113145-9113167 CCATAGCAAAAGTGAGCAAATGG + Intergenic
1020730248 7:11870462-11870484 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1020742824 7:12043431-12043453 ACATTGGAAAAGAGTGAAAATGG + Intergenic
1021519757 7:21527322-21527344 CCATTCCAAAAAAGAGAAATTGG - Intergenic
1021556558 7:21925191-21925213 CCATGGCCACACAGACAAAATGG + Intronic
1021573232 7:22085584-22085606 CCATTCCAAATGAGAGAAATTGG + Intergenic
1021761958 7:23910823-23910845 CCATTCCAAAAGATAGAAATAGG - Intergenic
1022678477 7:32522483-32522505 CCATTCCAAATGAGAGAAATTGG - Intronic
1022852679 7:34281769-34281791 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1022861929 7:34376509-34376531 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1023030934 7:36089885-36089907 CCATTCCAAAAGGGAGAAACTGG - Intergenic
1024077318 7:45828364-45828386 TCATTTGCAAAGTGAGAAAATGG + Intergenic
1024083904 7:45878001-45878023 CCATTTCAAAAGGGAGAAATTGG + Intergenic
1024089950 7:45928540-45928562 CCATTCCGAAAGGGAGAAATTGG - Intergenic
1024545279 7:50512593-50512615 CAAGAGCCAAAGTGAGAAAAAGG + Intronic
1024577318 7:50775212-50775234 CCATTACAAAAGGGAGAAATAGG + Intronic
1024643959 7:51355972-51355994 CCAATGCCAAAGAGAGATGAAGG - Intergenic
1024684851 7:51734139-51734161 CCATTCCAAATGAGAGAAATTGG + Intergenic
1024731552 7:52259056-52259078 CCCTTGACAAAGTGAGGAAATGG - Intergenic
1024876989 7:54037275-54037297 CCATTCCAAAAGTGAGAAATTGG + Intergenic
1024946401 7:54811994-54812016 CCACTGCCAAAGAGAAGAAAGGG + Intergenic
1025127095 7:56353060-56353082 CCATTTGCAAAGTGAGAAAACGG - Intergenic
1026292235 7:69018222-69018244 CCATTCCAAAAGAAAGAAACTGG + Intergenic
1026452328 7:70540286-70540308 CCCTTCCCAAAGAGAGAGGATGG - Intronic
1026548332 7:71344687-71344709 ACATTGCCAGAGAGAGAAGAGGG + Intronic
1026642513 7:72139837-72139859 TCATTTGCAAAGAGAGATAAGGG - Intronic
1027159100 7:75789556-75789578 CCATTGCCAAAGGCAGGGAAAGG - Intronic
1028249182 7:88520598-88520620 CCATTGTCAATAAAAGAAAATGG - Intergenic
1028262539 7:88683882-88683904 CCATTGCCAATGCCAGAAGAAGG - Intergenic
1028366499 7:90038532-90038554 TCATTTTCAAAGAGAGATAATGG - Intergenic
1028366759 7:90041025-90041047 CCATTCCCAAAGGAAGAAAATGG - Intergenic
1028619653 7:92811048-92811070 CCAGCGCCAAAGAAAAAAAAAGG + Intronic
1029047550 7:97645857-97645879 CCATTCCAAATGAGAGAAATTGG - Intergenic
1029119977 7:98261310-98261332 CCATTCCAAAAGGGAGAAATTGG + Intronic
1029169371 7:98619872-98619894 CCACTGCCAGACAGAGAAACAGG - Intronic
1029277781 7:99417835-99417857 CCATTTCCTAAGTGAGGAAAGGG - Exonic
1029873291 7:103719016-103719038 CTATTGCTCAAGAGAGAAAGAGG + Intronic
1029961534 7:104693156-104693178 CTATTGCAAATGAGAGAAATTGG - Intronic
1030516904 7:110550338-110550360 CCATTTCAAAAGGGAGAAATTGG + Intergenic
1030533359 7:110736693-110736715 CCATTTCAAAAGGGAGAAATAGG - Intronic
1030731518 7:112995468-112995490 GGCTTGACAAAGAGAGAAAATGG - Intergenic
1030817252 7:114053133-114053155 CCATTCCAAAAGGGAGAAATGGG - Intronic
1031194261 7:118591744-118591766 CCATTCCAAAAGGTAGAAAATGG - Intergenic
1031208409 7:118792177-118792199 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1031226302 7:119042074-119042096 CCATTTCAAAAGGGAGAAATAGG - Intergenic
1031258658 7:119488853-119488875 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1031280283 7:119791201-119791223 CCATATCCAAAGAGAAAGAAGGG - Intergenic
1031298766 7:120038740-120038762 CCATTCCAAATGAGAGAAATTGG + Intergenic
1032330587 7:130975402-130975424 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1033616720 7:143023498-143023520 CCATTCCAAAAGAAAGAAATAGG - Intergenic
1033919374 7:146370431-146370453 CCTTTTCAAAAAAGAGAAAAAGG + Intronic
1034211132 7:149364301-149364323 CCCTTGCCAATGAGAAATAATGG - Intergenic
1035100398 7:156391447-156391469 CCATTGCAGGAGTGAGAAAATGG + Intergenic
1035120660 7:156564086-156564108 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1036518579 8:9468973-9468995 CCTTTCCAAAAGAGAGAAATTGG - Intergenic
1037131595 8:15413347-15413369 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1037259623 8:16993407-16993429 GCCTTGTCAAAGAAAGAAAAAGG + Intronic
1037365822 8:18121496-18121518 CCATTCCAAAAGACAGAAATTGG + Intergenic
1037415304 8:18643573-18643595 CCATTCCAAAAGGGAGAAATAGG + Intronic
1037457997 8:19082954-19082976 CCCTTGTTAAAAAGAGAAAAGGG + Intronic
1038139120 8:24823049-24823071 CCATTCCAAATGAGAGAAATTGG - Intergenic
1039178201 8:34833368-34833390 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1039532484 8:38275963-38275985 CCATCTCCAATGAGAGAAGAAGG - Intronic
1039647707 8:39305553-39305575 CCATTCCAAAAGAGAGAAATAGG + Intergenic
1039651097 8:39340183-39340205 CCATTCCAAAAGGGAGAAATAGG + Intergenic
1040865857 8:52048389-52048411 TCATTGCTCAAGAGAGGAAAAGG - Intergenic
1040979770 8:53234393-53234415 CCCTTGTTAAAGAGAAAAAAAGG + Intronic
1041016865 8:53599901-53599923 CCAATCCAAAAGAAAGAAAATGG + Intergenic
1041140692 8:54816141-54816163 ACAATCCCAATGAGAGAAAAGGG + Intergenic
1041403739 8:57473349-57473371 CTATTCCAAAAGGGAGAAAAAGG + Intergenic
1041908617 8:63062601-63062623 GCATTGCCAAAAAGTTAAAAAGG + Intronic
1042305882 8:67332659-67332681 GCACTGTCAAAAAGAGAAAAAGG - Intronic
1042412600 8:68481731-68481753 CCATTCCAAAAGGGAGAAATTGG - Intronic
1043561558 8:81499668-81499690 CCAGTGCCAGAGAGAGAATGAGG - Intergenic
1043812067 8:84753231-84753253 CCATTCCAAAAGGGAGAAATTGG - Intronic
1044307098 8:90650391-90650413 CCATAGCCACACAGAGAAAGTGG + Intronic
1044555658 8:93559275-93559297 GAATTCCCAAAAAGAGAAAAAGG + Intergenic
1045198109 8:99950503-99950525 CATATGCCAGAGAGAGAAAAGGG - Intergenic
1045234258 8:100336184-100336206 GCAGTGCCAATGAGAGAAGAGGG + Intronic
1045597118 8:103669595-103669617 CCATTCCCAATGGGAGAAATTGG + Intronic
1045652127 8:104351122-104351144 CCATGGACAAACAGAGAAGATGG + Intronic
1045669850 8:104538174-104538196 GCATTGTTAAAAAGAGAAAAAGG + Intronic
1045753737 8:105516692-105516714 CCCTCGCCAAAAAAAGAAAAGGG - Intronic
1045784227 8:105902315-105902337 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1046232376 8:111374174-111374196 CCATTCCAAATGAGAGAAATTGG - Intergenic
1046272653 8:111916619-111916641 CCATTCCAAAAGGGAGAAATAGG + Intergenic
1047846355 8:128809877-128809899 CCATTCCAAAAGAAAGAAATAGG - Intergenic
1048038927 8:130706514-130706536 CCATTGCAAATGGGAGAAATTGG + Intergenic
1048046173 8:130775341-130775363 CCATTCCAAATGAGAGAAATTGG - Intergenic
1048111644 8:131474120-131474142 CCATTCCAAATGAGAGAAATTGG - Intergenic
1048137499 8:131760241-131760263 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1048213524 8:132476602-132476624 CCATTGCAAACGGGAGAAATTGG - Intronic
1048571518 8:135660908-135660930 CCATTGCAAAAGGGAGAAATAGG + Intergenic
1048668277 8:136689072-136689094 CCATTTCAAATGAGAGAAATTGG + Intergenic
1049517191 8:143066634-143066656 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1049665850 8:143842092-143842114 CCTCTGCCAAAGAAAGAAAGAGG - Intergenic
1050054222 9:1635135-1635157 CCATTGCACCACAGAGAAAATGG + Intergenic
1050057564 9:1671830-1671852 CCATTCCAAAAGGGAGAAATAGG + Intergenic
1050288731 9:4131109-4131131 CCATTCCAAAAGGGAGAAATTGG - Intronic
1050522376 9:6514545-6514567 CCATGGACAAAGAGAGTACAAGG - Intergenic
1050674438 9:8036381-8036403 CCATTCCAAAAGAGAGAAATTGG + Intergenic
1051663983 9:19451036-19451058 CCTTTCCCAAAGATGGAAAATGG + Exonic
1051990303 9:23145049-23145071 CCATTGCAAATGTGAGAAACTGG + Intergenic
1052090390 9:24320324-24320346 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1053027659 9:34743717-34743739 CCATCTCCAAAAGGAGAAAATGG - Intergenic
1053060781 9:35029596-35029618 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1053089821 9:35264865-35264887 CCATTCCAAAAGAGAGAAACAGG - Intronic
1053616313 9:39770109-39770131 CCATTCCAAATGAGAGAAATTGG + Intergenic
1053627279 9:39888031-39888053 CCATTTCAAAAGGGAGAAATTGG + Intergenic
1053633050 9:39964947-39964969 CCATTGCAAATGGGAGAAATTGG - Intergenic
1053648557 9:40140443-40140465 CCATTACAAAAGAGAGAAATTGG + Intergenic
1053757188 9:41323399-41323421 CCATTACAAAAGAGAGAAATTGG - Intergenic
1053772701 9:41498586-41498608 CCATTGCAAATGGGAGAAATTGG + Intergenic
1053778714 9:41577994-41578016 CCATTTCAAAAGGGAGAAATTGG - Intergenic
1053874480 9:42529416-42529438 CCATTCCAAATGAGAGAAATTGG + Intergenic
1053898136 9:42765171-42765193 CCATTCCAAATGAGAGAAATTGG - Intergenic
1054166676 9:61788234-61788256 CCATTTCAAAAGGGAGAAATTGG - Intergenic
1054210838 9:62285750-62285772 CCATTGCAAATGGGAGAAATTGG + Intergenic
1054216608 9:62362672-62362694 CCATTTCAAAAGGGAGAAATTGG - Intergenic
1054237204 9:62572280-62572302 CCATTCCAAATGAGAGAAATTGG - Intergenic
1054267855 9:62937339-62937361 CCATTCCAAATGAGAGAAATTGG - Intergenic
1054329538 9:63738388-63738410 CCATTACAAAAGAGAGAAATTGG + Intergenic
1054536026 9:66235727-66235749 CCATTACAAAAGAGAGAAATTGG - Intergenic
1054551340 9:66606791-66606813 CCATTCCAAATGAGAGAAATTGG - Intergenic
1054670874 9:67792671-67792693 CCATTTCAAAAGGGAGAAATTGG + Intergenic
1054706046 9:68463007-68463029 CCATTGAAAAAGAGAGAAGACGG + Intronic
1054947551 9:70811881-70811903 CCTTGGCCAGAGAGAGAAAGAGG - Intronic
1054956078 9:70911917-70911939 CCATTGCCAGAAGGAGAGAACGG - Intronic
1055147870 9:72958430-72958452 CCATTCCAAAAGGGAGAAATTGG + Intronic
1055223907 9:73970538-73970560 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1055706732 9:79013470-79013492 CTATTGCCAAAGAGACAACTTGG + Intergenic
1056192603 9:84199037-84199059 CCATTCCGAAAGGGAGAAATTGG + Intergenic
1057361566 9:94378119-94378141 CCATTTCCAAAAAAAAAAAAAGG + Intronic
1057386136 9:94607314-94607336 CCTTTACCAAACAGAAAAAAGGG + Intronic
1057690730 9:97281936-97281958 CCATTGGCATTGAGACAAAATGG - Intergenic
1057913287 9:99036438-99036460 CCTTTGCCAAAGGGAGGAGAAGG + Intronic
1057969910 9:99545007-99545029 CCATTGCAAAAGGGACAAACAGG + Intergenic
1058801864 9:108552338-108552360 TCATTCCCACAGTGAGAAAAAGG + Intergenic
1059082513 9:111265537-111265559 CCATTGCAAAAGAAAGAAATTGG + Intergenic
1059089852 9:111344380-111344402 CCATCATCAAAGAGTGAAAACGG + Intergenic
1059552047 9:115238865-115238887 CTATTGCCTAAGAAATAAAATGG - Intronic
1059877202 9:118647741-118647763 CCATTCCAAAAAAGAGAAATAGG - Intergenic
1060030313 9:120209234-120209256 TCATTTTCAAGGAGAGAAAATGG - Intergenic
1061487738 9:130928840-130928862 CCATTTTCCAAGACAGAAAATGG - Intronic
1061771685 9:132928942-132928964 CCACTACCAAACTGAGAAAAAGG + Exonic
1062438906 9:136560430-136560452 CCATTTCAAAAGGGAGAAATTGG - Intergenic
1185564480 X:1084960-1084982 GAATTGCCAAAGAGAGAGGAAGG - Intergenic
1186637122 X:11418473-11418495 TCCTTGCCAAACAAAGAAAAAGG - Intronic
1186996391 X:15128095-15128117 CCATTGACAAATTGGGAAAATGG - Intergenic
1187133523 X:16525592-16525614 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1187555269 X:20345123-20345145 CCATTCCAAATGAGAGAAATTGG - Intergenic
1187574844 X:20542962-20542984 CCATTCCAAATGAGAGAAACTGG - Intergenic
1187836621 X:23437785-23437807 CCATTCCAAAAGGGAGAAAGAGG - Intergenic
1187843266 X:23510151-23510173 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1187944960 X:24416818-24416840 TCATTCCAAAAGAGAGAAATAGG - Intergenic
1188115512 X:26238393-26238415 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1188174899 X:26977206-26977228 CCATCGCCAAAAAGAGAAAGAGG - Intergenic
1188517659 X:31004913-31004935 GCATGGCAAAAGAGAGAGAAGGG + Intergenic
1188927758 X:36066771-36066793 TCATTCCCAAAGAGCAAAAAGGG + Intronic
1188957641 X:36452667-36452689 TCATTGACATAGAGAGTAAAAGG + Intergenic
1189158134 X:38781135-38781157 CCATTTCAAAAGGGAAAAAATGG - Intergenic
1189185914 X:39054748-39054770 ACATTGAAAAAGAGAGAAAGAGG - Intergenic
1189253654 X:39620801-39620823 CCATTGCAAATGGGAGAAATTGG + Intergenic
1189858805 X:45251407-45251429 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1190146343 X:47894795-47894817 CCATTCCAAAAGGGAGAAACTGG - Intronic
1190169962 X:48104445-48104467 CCATTTCAAATGAGAGAAACTGG - Intergenic
1190240474 X:48654332-48654354 CCATTCCAAAAGGGAGAAACAGG + Intergenic
1190512802 X:51191592-51191614 CCATTTCAAAAGGGAGAAATTGG + Intergenic
1190953702 X:55171331-55171353 CCATGGCCACGTAGAGAAAAGGG + Intronic
1191603727 X:63039679-63039701 CCATTCCAAATGAGAGAAATTGG - Intergenic
1192096205 X:68213654-68213676 CCATAGAAAAAGAGAGAAAAGGG + Intronic
1192116360 X:68415587-68415609 ACTGTGTCAAAGAGAGAAAAAGG + Intronic
1192565278 X:72158338-72158360 CCATTCCAAAAGAGAGAAATTGG + Intergenic
1192619896 X:72668929-72668951 CCATTCTAAAAGAGAGAAACAGG + Intronic
1192695985 X:73416607-73416629 CCATTCCAAAAGGGAGAAATAGG + Intergenic
1192704799 X:73518439-73518461 CCATTCCAAAAGGGAGAAATAGG + Intergenic
1193010131 X:76666700-76666722 CAATTCCTAAAGAGAGAAACTGG + Intergenic
1193031902 X:76907535-76907557 CCCTTGCCAGAAAGAGAAATTGG + Intergenic
1193225974 X:78985146-78985168 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1193230697 X:79041946-79041968 CCATTCCAAATGAGAGAAATTGG + Intergenic
1193424780 X:81328509-81328531 CCATTCCAAAAGGGAGAAATAGG - Intergenic
1193777250 X:85657934-85657956 CCATTTCAAAAGAGAGAAACTGG - Intergenic
1193879764 X:86907875-86907897 TCATTTCCAAAAGGAGAAAAAGG + Intergenic
1194032010 X:88828948-88828970 CCATTCCAAAAGGGAGAAATAGG - Intergenic
1194038777 X:88914718-88914740 CCATTCCCAAAGTAAGAAATTGG + Intergenic
1194135065 X:90130874-90130896 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1194302884 X:92209366-92209388 CTACTCCAAAAGAGAGAAAATGG + Intronic
1194572925 X:95574904-95574926 CCATTTCAAAAGGGAGAAATGGG - Intergenic
1194756389 X:97743851-97743873 CCATTCCAAATGAGAGAAATTGG - Intergenic
1194864358 X:99048135-99048157 CCATTCCAAAAGAGAGAAGTTGG + Intergenic
1195154303 X:102107946-102107968 CAATAGCTAAAGAGTGAAAAGGG + Intergenic
1195159994 X:102161929-102161951 CCACTCCCAAAGGGAGAAATTGG + Intergenic
1195510738 X:105712884-105712906 CCATTCCAAATGGGAGAAAATGG + Intronic
1195592105 X:106641531-106641553 CCATTCTGAAAGAGAGAAATTGG + Intronic
1196140079 X:112251852-112251874 CCAATGCCTAATAGAGAAACAGG + Intergenic
1196248741 X:113432021-113432043 CTCTTGCCAAAGACATAAAATGG + Intergenic
1196359657 X:114837552-114837574 CAAGTGCCAGAGATAGAAAAAGG - Intronic
1196518230 X:116639935-116639957 CCATTTCAAAAGGGAGAAATAGG + Intergenic
1196567607 X:117227321-117227343 CCATTCCAAAAGAGAAAAATAGG - Intergenic
1196706876 X:118724591-118724613 CCACTGCAAAACAAAGAAAAAGG - Intergenic
1196960398 X:120994101-120994123 CCATCGCAAAAGAAAAAAAAGGG - Intergenic
1197151444 X:123224256-123224278 CTTTTGCAAAAGTGAGAAAAGGG - Intronic
1197265263 X:124362464-124362486 CCATTCCAAAAGGGAGAAATTGG - Intronic
1197561165 X:128024190-128024212 CCATTTCAAATGAGAGAAACTGG + Intergenic
1197583120 X:128310430-128310452 CTATTCCCAAAGGGAGAAATTGG + Intergenic
1198127722 X:133662746-133662768 CCATTGCCAAAGAGAGAAAAAGG + Intronic
1198569853 X:137942877-137942899 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1198630155 X:138628413-138628435 CAATTTCTAAAGTGAGAAAATGG + Intergenic
1198679457 X:139165876-139165898 CCATTCCAAATGGGAGAAAATGG - Intronic
1198872908 X:141194373-141194395 CCATTACAAATGAGAGAAATTGG - Intergenic
1199063692 X:143389225-143389247 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1199116598 X:143999945-143999967 CCATTCCCAAAGAAAGAAGTAGG + Intergenic
1199203777 X:145124059-145124081 CCATTCCAAATGGGAGAAAATGG + Intergenic
1199235441 X:145487443-145487465 CCATTCCAAAAGGGAGAAATTGG + Intergenic
1199237832 X:145510910-145510932 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1199288008 X:146075337-146075359 CCAATCCCAGAGATAGAAAAAGG - Intergenic
1199291025 X:146105396-146105418 CCATTGCAAATGGGAGAAATTGG + Intergenic
1199350599 X:146795496-146795518 CCATTGCAAATGGGAGAAATTGG - Intergenic
1199480996 X:148298179-148298201 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1199499361 X:148493153-148493175 CCATTGCTTGAAAGAGAAAATGG - Intergenic
1199569294 X:149251891-149251913 CCATTCCAAATGAGAGAAATTGG + Intergenic
1199662409 X:150065331-150065353 CCATATCAAAAAAGAGAAAACGG - Intergenic
1199908673 X:152261488-152261510 CCATTCCAAATGAGAGAAACTGG + Intronic
1200340190 X:155388568-155388590 CTATTGCAAAAGATAGAGAAAGG - Intergenic
1200480847 Y:3700965-3700987 CCATTCCAAAAGGGAGAAATTGG - Intergenic
1201185618 Y:11399647-11399669 CCATTCCAAAAGGGAGAAATAGG + Intergenic
1201944103 Y:19492909-19492931 CCCTTGCCATAGAGGTAAAAAGG - Intergenic
1202391201 Y:24372432-24372454 CCATTACCCAAGGGAGAGAAGGG + Intergenic
1202479583 Y:25297684-25297706 CCATTACCCAAGGGAGAGAAGGG - Intergenic