ID: 1198128548

View in Genome Browser
Species Human (GRCh38)
Location X:133671808-133671830
Sequence CGGGGCCTGGCGTGGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11398
Summary {0: 1, 1: 15, 2: 422, 3: 3023, 4: 7937}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198128548 Original CRISPR CGGGGCCTGGCGTGGGATGG GGG (reversed) Intronic
Too many off-targets to display for this crispr