ID: 1198129709

View in Genome Browser
Species Human (GRCh38)
Location X:133681563-133681585
Sequence GCCACTTTCTTTGCTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198129709_1198129710 -1 Left 1198129709 X:133681563-133681585 CCAGTAGCAGCAAAGAAAGTGGC 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1198129710 X:133681585-133681607 CACCTGCCAGCCATTTCCTGTGG 0: 1
1: 0
2: 4
3: 24
4: 245
1198129709_1198129713 6 Left 1198129709 X:133681563-133681585 CCAGTAGCAGCAAAGAAAGTGGC 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1198129713 X:133681592-133681614 CAGCCATTTCCTGTGGCCTGTGG 0: 1
1: 0
2: 4
3: 37
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198129709 Original CRISPR GCCACTTTCTTTGCTGCTAC TGG (reversed) Intronic
901750034 1:11400424-11400446 GCCACTCTGCTTGCTGCTCCTGG + Intergenic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
906102565 1:43272624-43272646 GCCACCTGCTTGGCAGCTACAGG - Exonic
908025778 1:59950321-59950343 ACCATTTGCTTTGCTGCAACAGG + Intergenic
911199521 1:95030806-95030828 CCCATTTTCTTAGCTGCTCCAGG - Intronic
916168440 1:161983300-161983322 GCCTCTTTCATTTCTGCTCCTGG + Exonic
916569006 1:166008755-166008777 GCCACTATCTTTGCTGTTTGGGG - Intergenic
919301776 1:195779413-195779435 GCCATTTTCTTTGTTGTTATGGG + Intergenic
919845610 1:201640292-201640314 GCCACTGCCTTTGCTTCTCCAGG - Intronic
920167802 1:204048046-204048068 GCCAGTCTCTCTGCAGCTACTGG + Intergenic
920788814 1:209068900-209068922 TTCACTTTCTTTTCTGCTAGTGG - Intergenic
923626853 1:235621047-235621069 GCCCCTGTCCTTGCTCCTACAGG + Intronic
1063320246 10:5045612-5045634 CCCAATTTCTTTTCTGCTTCTGG - Intronic
1064240846 10:13626948-13626970 ACCACCTTCCTTGCTGCCACTGG + Intronic
1067701435 10:48575933-48575955 GCCCCTATCTGTGCTGCTGCAGG + Intronic
1069225110 10:65933403-65933425 TCCCCTTTCTTTCCTGCTCCAGG - Intronic
1069608958 10:69759636-69759658 GCCCCTTTCTCTCCTCCTACAGG + Intergenic
1070559227 10:77553362-77553384 GCCCCTTTCCTTGCTGCAGCAGG - Intronic
1071247249 10:83778466-83778488 GCCACTTTTTTTGGTGGTAGAGG + Intergenic
1072250340 10:93577353-93577375 GGCCCTTTCTTTGCAGCTAAGGG + Intronic
1073235649 10:102013280-102013302 GCCACTTTCTTTAAAGCCACAGG + Intronic
1073663554 10:105504859-105504881 GCCACTATCCTTCCTGCCACAGG - Intergenic
1075284224 10:121169136-121169158 CCCACCTACTTTGCTGCTCCAGG + Intergenic
1075957586 10:126537184-126537206 GCCATTTCCTTTGTTGCTTCTGG - Intronic
1079497271 11:21059756-21059778 GCATCTTCCTTTGCTGCTACTGG + Intronic
1079615670 11:22489725-22489747 TCAAATTTCTTTGCTTCTACAGG + Intergenic
1081590772 11:44421564-44421586 GCCATTTTGTTTGTTTCTACAGG + Intergenic
1081966328 11:47172279-47172301 ACCCCTTTCTTAGCTGCTGCTGG + Exonic
1083124057 11:60545347-60545369 GCTAGTTTCTTGACTGCTACAGG - Intergenic
1084581034 11:70023517-70023539 GGCACTTTCTTTACTTCTAGGGG + Intergenic
1085328391 11:75626330-75626352 TCCACCTTCTTTGCCTCTACTGG - Intronic
1085469400 11:76747625-76747647 GCAGCTTTCTTGGCTGCTACAGG + Intergenic
1089582622 11:119490873-119490895 GCCACTCTCTGGGCTGCTGCAGG + Intergenic
1092774555 12:11931091-11931113 GCCAAGATCTTTGCTGCTTCGGG + Intergenic
1092887686 12:12939441-12939463 GTCTCTTCCTTTGCTGTTACTGG + Intergenic
1094660427 12:32465368-32465390 GCCTCTTTCTTTGATGTTAATGG - Intronic
1098788037 12:74784084-74784106 ATCACTTTCTTTGCTGATACTGG + Intergenic
1099761768 12:86932295-86932317 TCCACTTTCTTTCTTTCTACAGG - Intergenic
1100016189 12:90013647-90013669 GTCTCTTTCCCTGCTGCTACTGG + Intergenic
1100026017 12:90128910-90128932 GCCATTTTCTGTGTTGCAACAGG + Intergenic
1102516252 12:113448801-113448823 GCCTCTTTCATTCCTTCTACTGG + Intergenic
1103508546 12:121457597-121457619 GTCACTTCCTTTGCTGGGACAGG - Intronic
1105535168 13:21259315-21259337 GCCACTGTGTGAGCTGCTACCGG + Intergenic
1109795471 13:67306998-67307020 GCCCCTTTCTGTGCTGCTGGTGG - Intergenic
1110303960 13:73963105-73963127 GCAATTTTCTTTACTGCTAGGGG - Intronic
1110666830 13:78126974-78126996 GTTATTTTCTTTCCTGCTACTGG + Intergenic
1112863654 13:103866749-103866771 CACATTTTCTTTGCTCCTACTGG + Intergenic
1115314610 14:32012994-32013016 ACCTCTTTCTCTGCTGCAACTGG - Intronic
1115338301 14:32264273-32264295 GCCTCTTTCTCTGCTTCTTCTGG - Intergenic
1117660792 14:58002248-58002270 GCCATTTTCCTTGCTGCTGGTGG - Exonic
1118561218 14:67085580-67085602 GCCTGTTTCTTTGGGGCTACTGG + Intronic
1122093961 14:99357721-99357743 TCCTCTTCTTTTGCTGCTACTGG - Intergenic
1122318834 14:100841225-100841247 GTCACTGACTTTGCTGCTGCTGG + Intergenic
1129051694 15:72786389-72786411 CCCACTTTCCTTGCAGCTCCAGG + Intergenic
1129951317 15:79594052-79594074 GCCCCTTTCTATGCTGCCTCTGG - Intergenic
1131144966 15:90004718-90004740 GCCACTGTCTCTGCTACTGCTGG + Intronic
1131641947 15:94302354-94302376 TTCACTTTCTTTGCTGATGCTGG - Intronic
1137077504 16:35990653-35990675 GACATTTCCTTTTCTGCTACAGG - Intergenic
1137567121 16:49540234-49540256 GCCACAGTCTTTGCTGTGACTGG - Intronic
1141368227 16:83463804-83463826 GCCACTTTCTTTGCTTTTTTTGG - Intronic
1141401545 16:83751476-83751498 TCCATTTTCTATGCTGCTATAGG - Intronic
1147323118 17:39657860-39657882 GCCACTTTCCTGGCAGCTTCTGG + Intronic
1147754036 17:42756379-42756401 GCCACTTCCTTTCTTGTTACAGG - Intergenic
1148097585 17:45063888-45063910 GCCACTTTTTTTTCTGAGACAGG - Intronic
1149250731 17:54766293-54766315 GCTAGTTTCTTTACTACTACGGG + Intergenic
1150031471 17:61740808-61740830 GTCACTCTCTTTGCTGGTAGAGG + Intronic
1150730256 17:67686607-67686629 GACACTTTCATTGCTGTTATAGG - Intronic
1153364922 18:4245098-4245120 GCTACGTTGTTAGCTGCTACTGG + Intronic
1155440272 18:25854946-25854968 GCCTCTTTCTTAGATGCTGCAGG + Intergenic
1155912836 18:31524565-31524587 ACCACTTTATTTTCTACTACAGG - Exonic
1160940941 19:1620187-1620209 GCCACTTTCTTGCCTGCTGCTGG - Intronic
1165145342 19:33726796-33726818 GCCCCTTTCTTTGCAGCCCCTGG - Intronic
925321563 2:2974148-2974170 GCCACTTTGTTTTCTGATGCTGG - Intergenic
926924342 2:17971916-17971938 TCCACTTTCTTTGCCATTACAGG - Intronic
930269255 2:49236586-49236608 GCAACTTTCCTTGTTGCTTCAGG - Intergenic
930879121 2:56251850-56251872 GCCACCTTCTCTCCTGCTACGGG - Intronic
933740984 2:85533714-85533736 GTCACTGTCTGTGCAGCTACCGG + Intergenic
938563572 2:132496403-132496425 ACAACTCCCTTTGCTGCTACAGG + Intronic
939003794 2:136764576-136764598 TCCACCTCCTTTGCTGCTTCCGG + Intergenic
942865046 2:180663304-180663326 GTCACTTTCTTTGCTGATCAGGG + Intergenic
943446109 2:187990000-187990022 GCCATTGTCTTTTGTGCTACTGG + Intergenic
944324126 2:198383461-198383483 CCCATTTTCTTTGATTCTACTGG - Intronic
946482928 2:220074108-220074130 GCCACCCTCTCTGCTGCCACTGG + Intergenic
947958793 2:234217429-234217451 GCGACTTTTATTGCTGCCACAGG - Intergenic
948350508 2:237336248-237336270 GCTGCTGGCTTTGCTGCTACAGG + Exonic
949063712 2:241976341-241976363 GCGGCTTTCTTGGCTGCTGCAGG - Intergenic
1168852786 20:988103-988125 ACCACGTTCTTTGCCGCTTCTGG - Intronic
1169453029 20:5728534-5728556 ACCACTGTCTTTGATGCTAAAGG + Intergenic
1170006758 20:11677972-11677994 TCCACTTGCTTTGCTACTAATGG + Intergenic
1170439867 20:16368275-16368297 GCCTCTGTCTTTGCAGCTACAGG - Intronic
1170962409 20:21037228-21037250 TCCATTTGCTTTGCTGTTACTGG - Intergenic
1172919752 20:38471625-38471647 TCAACTTTCTTTGCTGCTAAGGG - Intergenic
1173015896 20:39225497-39225519 GACACTTTTTTTGCTGCTGAAGG + Intergenic
1175037483 20:56014090-56014112 GCCACTTTCTTATCTACCACTGG + Intergenic
1179081220 21:38172345-38172367 CCCTCTTTCTCTGCTGCAACTGG - Intronic
1179412914 21:41175790-41175812 GCCACTTTCCTGCCAGCTACAGG - Intronic
1181889402 22:26048518-26048540 GCCACTTTCATTTCTGCTGATGG - Intergenic
1184205250 22:42998267-42998289 GGAACCTTCTTTGCTGCTGCAGG + Intronic
951178331 3:19628654-19628676 GACACTGTCTCTGCTGCTGCTGG + Intergenic
951568244 3:24034668-24034690 GGCACTGTCCTTGGTGCTACAGG + Intergenic
954972354 3:54661937-54661959 ACCACTTCTTTTCCTGCTACAGG + Intronic
955516020 3:59727223-59727245 GCCTCTTTCCTGGCTGCTGCTGG - Intergenic
955632560 3:60990241-60990263 GCCACTCTCTTAGCTGCTGTTGG - Intronic
957971775 3:87391111-87391133 GCCACTCTCTGAGCTGGTACTGG - Intergenic
962036582 3:131658243-131658265 TCCAGCTTCTTTGCTGGTACAGG - Intronic
963199393 3:142570771-142570793 GCTTCTCTCTTTACTGCTACAGG - Intronic
966749787 3:183310872-183310894 GTAACTTTCTTTTCTGGTACCGG - Intronic
966968786 3:185022651-185022673 TCCTCTTTCATTGCTGATACTGG + Intronic
967294153 3:187949183-187949205 GCCTCTTTCTTTGCTCTTTCAGG - Intergenic
968781282 4:2583540-2583562 GCTACTGTCTTTGCTTCTTCGGG + Intronic
969330037 4:6469321-6469343 GCCATTTTCTTTCTTGCTTCAGG - Intronic
973956689 4:56069751-56069773 GACAGCTTCTTTGCTGCTCCAGG - Intergenic
977616020 4:99088469-99088491 GCAGCTTTCTTTGCTGCTTCTGG - Intronic
979332039 4:119429476-119429498 GCCACCTTATTTTCTGTTACTGG - Intergenic
979638852 4:122988720-122988742 GCCCCTTTCTCTGCTTCTTCTGG + Intronic
981956968 4:150487786-150487808 ACCACTTTCTTTACTGTTGCAGG + Exonic
985767225 5:1786353-1786375 GCCTCTTTCTGTGCTGGTCCTGG - Intergenic
986249924 5:6046143-6046165 GACACTTTCCTTCCTGCTCCAGG + Intergenic
989273681 5:39561625-39561647 GCCCCTTTCCTTGCTCCTAGTGG + Intergenic
990815579 5:59781344-59781366 GGCAATTTCTTTGCTGCATCTGG + Intronic
993167229 5:84373039-84373061 ACCAGTTCCTTTGCTGCTCCAGG + Intronic
995159861 5:108967076-108967098 GCCACTTTACTTGCTGCAACAGG + Intronic
995659919 5:114470113-114470135 GCTCCATTCTTTTCTGCTACTGG - Intronic
1004783502 6:18939371-18939393 GCTATTTTCTTTGCTGCTTCGGG + Intergenic
1005652277 6:27895265-27895287 GTCACTTCCTTTGCAGCTATGGG + Intergenic
1005675922 6:28154725-28154747 TCCACTTTCTTTACTGACACAGG - Exonic
1005899905 6:30208271-30208293 CCCACTGTTCTTGCTGCTACAGG - Intronic
1008370462 6:50724738-50724760 GCCACCGTCTGTGCTGCAACTGG - Intronic
1011955239 6:93017395-93017417 GCCTCTGCCCTTGCTGCTACTGG + Intergenic
1018169093 6:161129921-161129943 TCCACTTTCCTTGCAGATACTGG + Intergenic
1019824881 7:3275748-3275770 GCCAATCTCTTTCCTGCTTCAGG - Intergenic
1020150996 7:5681538-5681560 GACACTGTCCTTGGTGCTACAGG - Intronic
1021464623 7:20928208-20928230 GCAGCTTTGTTTGCTGCCACTGG - Intergenic
1022637655 7:32152336-32152358 GTCACTGTCTTTTCTGCTCCTGG - Intronic
1022676140 7:32501036-32501058 GCCATTTTCTTCACTGCTGCTGG - Intronic
1022887692 7:34663285-34663307 GCCACATTCTCTCCTGGTACAGG + Intronic
1023659965 7:42461048-42461070 GCCAACATCTCTGCTGCTACAGG - Intergenic
1023960108 7:44919446-44919468 GACACTTTCTTAACTGCTTCTGG - Intergenic
1024156363 7:46629709-46629731 ACCACCTTCTTTGCTGCTGGTGG - Intergenic
1031030999 7:116735162-116735184 GGCACTGTCACTGCTGCTACTGG + Intronic
1031056695 7:116999459-116999481 TCCATTTTCTTTTCTGTTACTGG - Intronic
1034050881 7:147983297-147983319 TCCTTTTTCTTTGCTGCTTCAGG + Intronic
1034408363 7:150921773-150921795 GCCTCTGTCTCTGCTGCCACAGG + Intergenic
1035634619 8:1135134-1135156 GACAGTTTTTTTGCTGCTATTGG + Intergenic
1035948361 8:3990869-3990891 GCCACCTTCTTTGCTCCTGGAGG + Intronic
1035999656 8:4586765-4586787 GGCACTTTCTGTGCTCCTCCAGG + Intronic
1037164130 8:15806379-15806401 GCCTCCTTCTTCGCTGCTTCTGG + Intergenic
1037631881 8:20665277-20665299 GCCCCTTTCTTTTCTGACACTGG + Intergenic
1037907742 8:22725394-22725416 GCCAATTTCTTGGCTGCGTCTGG + Intronic
1040046295 8:42967314-42967336 GCCTCTTTCTTCGCTGCTATAGG - Intronic
1044420639 8:91991874-91991896 GCCATTTTCTTTGGTTCTAAAGG + Exonic
1048440323 8:134454925-134454947 GCCACTTGCTCTGCTGCTCATGG - Intergenic
1051960299 9:22752664-22752686 GCCCAATTATTTGCTGCTACGGG - Intergenic
1052017655 9:23487935-23487957 GCCAATTTCTTTCCTGCCTCAGG - Intergenic
1052863897 9:33453428-33453450 GTCTCTTTCTTTGCTGGTTCGGG - Intergenic
1055160108 9:73116145-73116167 GATATTTTGTTTGCTGCTACTGG + Intergenic
1059230584 9:112717902-112717924 GCCGCCGTCTTTGTTGCTACAGG - Intronic
1059250970 9:112887740-112887762 GCCCCTTTCTTTGTTTCTCCAGG + Intronic
1059659426 9:116386785-116386807 GACCCCATCTTTGCTGCTACTGG - Intronic
1061564541 9:131429331-131429353 GCCACTTTCTAATGTGCTACAGG - Intronic
1187432804 X:19240147-19240169 GCCTCTTTCTTGGCTGCTTTTGG + Intergenic
1188569033 X:31560021-31560043 GCCACCTGCTTAGCTCCTACAGG + Intronic
1188832533 X:34917527-34917549 GCTACTTTCTGGGCTGGTACGGG + Intergenic
1188993046 X:36847519-36847541 GCTACTTTCTGGGCTGGTACTGG - Intergenic
1189172567 X:38924045-38924067 GCCACTTTCCTTTATGCCACAGG - Intergenic
1189332528 X:40152590-40152612 GCCGCTTTCTCTCCGGCTACCGG + Intronic
1190570910 X:51780328-51780350 TCCATTTTCTTTCCTGCCACAGG + Intergenic
1192314516 X:70041592-70041614 TGCCCTTTCTTTGCAGCTACTGG - Exonic
1194256486 X:91641896-91641918 GCCCCTTTCTTTTCTACTAAAGG - Intergenic
1194341308 X:92709612-92709634 GCCACTTTCATTGCTAAAACTGG - Intergenic
1194423428 X:93706287-93706309 GACTCTTTCTTTTCTGATACTGG + Intronic
1195006224 X:100688360-100688382 GCCACTTTGCATGCTGCTTCTGG + Exonic
1195175131 X:102307549-102307571 GGCACTTTATTTGCTGCCACAGG - Intronic
1195183734 X:102379544-102379566 GGCACTTTATTTGCTGCCACAGG + Intronic
1195253128 X:103067486-103067508 ACCTTTTTCTTTGCTGCTCCTGG + Intergenic
1198129709 X:133681563-133681585 GCCACTTTCTTTGCTGCTACTGG - Intronic
1200649660 Y:5826325-5826347 GCCACTTTCATTGCTAAAACTGG - Intergenic
1201955815 Y:19621342-19621364 GACTCTTTCTGTACTGCTACTGG - Intergenic