ID: 1198134673

View in Genome Browser
Species Human (GRCh38)
Location X:133736718-133736740
Sequence CAGGGGAGATGGAGAGTAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 487}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198134671_1198134673 -9 Left 1198134671 X:133736704-133736726 CCAGGTATGGGGGACAGGGGAGA 0: 1
1: 2
2: 4
3: 29
4: 334
Right 1198134673 X:133736718-133736740 CAGGGGAGATGGAGAGTAATAGG 0: 1
1: 0
2: 3
3: 46
4: 487
1198134663_1198134673 6 Left 1198134663 X:133736689-133736711 CCAGATTAGTTTTTGCCAGGTAT 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1198134673 X:133736718-133736740 CAGGGGAGATGGAGAGTAATAGG 0: 1
1: 0
2: 3
3: 46
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198134673 Original CRISPR CAGGGGAGATGGAGAGTAAT AGG Intronic
902217853 1:14945722-14945744 CAGGCAGGCTGGAGAGTAATCGG + Intronic
902278459 1:15356972-15356994 CAGGGGAGAAGAAAAGAAATCGG - Intronic
903291384 1:22316326-22316348 CTGGGGTGAAGGAGAGTCATTGG + Intergenic
903754420 1:25651030-25651052 AAGGGGAGAAGGTGAGTAAGTGG + Intronic
904026213 1:27505132-27505154 CTGGGGAGTTGGAGAGAACTAGG + Intergenic
904842844 1:33384644-33384666 CCAGGGAGATGGAGAGTGAGGGG - Intronic
906246628 1:44280365-44280387 CAGTGGAAATGTAGAGAAATGGG - Intronic
906669764 1:47645873-47645895 CAAGGGAGATGGAGAGGGACTGG + Intergenic
906694665 1:47815980-47816002 CTGGGGAGACTGAGATTAATGGG + Intronic
907093684 1:51754067-51754089 CAGTGGAGCTGGGGAGTAAGGGG + Intronic
907259681 1:53208230-53208252 CAGGGGATTTAGAGAGGAATAGG - Intronic
907853767 1:58281428-58281450 TAGTGGAGATGGAGAGATATAGG - Intronic
908466849 1:64404625-64404647 GAGGGTAGGTGGAGAGGAATGGG - Intergenic
908522227 1:64955515-64955537 CAGTGTAGAAGGAGAGAAATAGG + Intronic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
908982621 1:69977048-69977070 CAATGGAGATGCAGAGTATTGGG - Intronic
909845663 1:80390725-80390747 AAGGGGAGATAGAGAGAAGTTGG + Intergenic
909914235 1:81298052-81298074 CAGAGAAGATGGAGAGGACTGGG + Intergenic
910117255 1:83745654-83745676 CAGGGGGGCTAGAGAGTTATTGG - Intergenic
911067821 1:93807397-93807419 AAGGGGAGATGGAGAATGATGGG + Intronic
911752783 1:101516877-101516899 CAGGGGAGAGAGAGAGTGAAGGG + Intergenic
912552519 1:110493359-110493381 CAGAGGAGTTGGAGAGGAGTTGG - Intergenic
913270745 1:117090764-117090786 GAGGGGAGAAGGAGAAAAATGGG - Intronic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
914360299 1:146929795-146929817 CAGGGGAGTAGGAGAGTTAATGG + Intergenic
914800115 1:150955049-150955071 CAGAGGAGATCGAGACTACTGGG + Intronic
916825077 1:168435244-168435266 CTGGGGGGATGGAGAGCAACAGG - Intergenic
918127346 1:181596108-181596130 CCGGGGAGATTGAGAGAAAGAGG + Intronic
918152056 1:181806086-181806108 CCTGGGAGATGGAGAGAAAGAGG + Intronic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918352326 1:183670134-183670156 GTGGGGAGATGGAGAGAGATAGG - Intronic
918623571 1:186632910-186632932 CAGGGGAAATGGAAATGAATGGG + Intergenic
919598887 1:199599001-199599023 CAGGGGAGACGAAGAGAAATTGG + Intergenic
920118508 1:203638126-203638148 GAGGGGAGATGGGGAGGAAGGGG + Intronic
920616144 1:207494774-207494796 AATGGGAGATGGAGAGAGATTGG + Intergenic
920632717 1:207668526-207668548 AATGGGAGATGGAGAGAGATTGG + Intronic
921226425 1:213024595-213024617 CTTGGGAGATGGAGAGAAAAGGG - Intergenic
922295351 1:224245307-224245329 CAGGGCAGATTGAGAGGAAGAGG - Intronic
922659155 1:227414082-227414104 CTGAGGAGAGGGAGAGAAATGGG + Intergenic
923210522 1:231799984-231800006 AAGGGGTGATGAAAAGTAATTGG - Intronic
923374642 1:233348630-233348652 CAAGGAAGATGGAGAGAAATCGG - Intronic
924518037 1:244782348-244782370 TGGGGGAGATGGAAAGGAATTGG - Intergenic
1063315001 10:4995127-4995149 CAACAGAGGTGGAGAGTAATAGG - Intronic
1063515089 10:6687737-6687759 CAGGGGACGAGGAGAGTAAGTGG + Intergenic
1063592380 10:7407389-7407411 GAGGGGGGATGGAGAGTGGTGGG + Intronic
1064325135 10:14343433-14343455 GAGGGGAGATGGAGAGGAGCTGG - Intronic
1064550245 10:16493324-16493346 CAGGGGTGTTTGAGAATAATTGG + Intronic
1064847918 10:19676809-19676831 CAGGGGAGAGGGAGAGCATCAGG - Intronic
1064989901 10:21247047-21247069 CAGGGGAGAGAGAGAGTGAAGGG - Intergenic
1065886825 10:30085671-30085693 CAGTGGAGATGGGGAGTGATAGG + Intronic
1066230702 10:33429983-33430005 TAGGGGGGAAGGAGAGTGATAGG + Intergenic
1066290359 10:34008744-34008766 CTAGGGTGATGGAGAGGAATGGG + Intergenic
1066377080 10:34867193-34867215 CAGGGGAAATGAATAGTTATTGG - Intergenic
1066499426 10:35975498-35975520 CAAGGGAGATGGTGAGTGACAGG - Intergenic
1066826790 10:39602608-39602630 GAGGGGAGAGGGATAGTATTGGG - Intergenic
1067669057 10:48303202-48303224 CAGGGGAGAGGGAGTGTCCTTGG + Intergenic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1068305120 10:55198820-55198842 CAGGAGAGAGGGAGAGCAAAGGG - Intronic
1068543574 10:58322939-58322961 CAGGGGAATGGGAAAGTAATGGG + Intergenic
1068603769 10:58982677-58982699 CAGGGAAGCTGGAGTGTATTAGG + Intergenic
1068816988 10:61327650-61327672 CAGGGGAAAGAGATAGTAATTGG + Intergenic
1069166931 10:65171894-65171916 TAGTGGAGATGGAGAAGAATAGG + Intergenic
1069882461 10:71602282-71602304 CAGGGAAGATGGAGAGGGCTCGG + Intronic
1070042191 10:72792680-72792702 GAGGGGAGAGGGAGAGTTATTGG - Intronic
1070438460 10:76416767-76416789 CTGGGGAGATGAAGTGGAATAGG - Intronic
1071095392 10:81968345-81968367 CAGGGGAGAGTGAAAGTGATGGG + Intronic
1071202494 10:83235450-83235472 CATGAGAGATGGAGAGTGACCGG - Intergenic
1071913760 10:90266748-90266770 CTGGGGGGAGGGAGAGTATTAGG + Intergenic
1073036338 10:100566646-100566668 CAGGGGCAATGGAGAGCCATGGG + Intergenic
1073447335 10:103589542-103589564 CAGGGGAGCAGGGGAGTGATGGG - Exonic
1074497791 10:113995126-113995148 CATGGGTTATGGAGAGAAATAGG + Intergenic
1074554282 10:114474233-114474255 CAGTAGAGAGGGAGAGAAATGGG - Intronic
1074845550 10:117394180-117394202 CAGGAGAGATGGAGAATGCTAGG - Intergenic
1075208875 10:120473764-120473786 CAGGGGAGAGAGAGAGTGAAGGG - Intronic
1075488109 10:122843749-122843771 CAGGAGAAATGGAGAGTGAATGG + Intronic
1076262294 10:129076424-129076446 CACAGGAGATGGAGAGAGATAGG - Intergenic
1076947802 10:133664402-133664424 GAGGGGAGATGGGGAGACATTGG + Intergenic
1076954707 10:133740581-133740603 GAGGGGAGATGGGGAGACATTGG + Intergenic
1077280252 11:1741407-1741429 CAGGGGAGATGGATGGTGCTGGG + Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078822260 11:14894007-14894029 CGTGGGAGATGGAGAGAAATTGG - Intergenic
1079148611 11:17876957-17876979 CAGAGGAGGTGGGGAGTAACAGG - Intronic
1079161831 11:18002223-18002245 CAGTTGGGATGGAGAGTAAGAGG - Intronic
1079709099 11:23658707-23658729 CAGGGGAGAGAGAGAATGATAGG - Intergenic
1080360499 11:31507667-31507689 CAGGGGGGATGGGGAGAATTTGG + Intronic
1081579094 11:44339776-44339798 CAGGAGAGATTGAGAGTCCTGGG + Intergenic
1081591391 11:44425601-44425623 CAGGTGAGATGGAGGGTTCTTGG + Intergenic
1082930007 11:58592679-58592701 AAGGGGAGATGGAGATGAAAAGG + Intronic
1083987879 11:66228739-66228761 CAGGGGAGAGGGAGGGGCATCGG + Intronic
1084461614 11:69299459-69299481 CAGGGGAGATGCAGAGGAGGGGG + Intronic
1084557927 11:69885841-69885863 GTGGGGAGATGGAGAGTGATCGG + Intergenic
1085198458 11:74686534-74686556 CATGGGAGATGCTCAGTAATTGG + Intergenic
1085731372 11:79001969-79001991 CAGGGGAGATGGGGAGCTATGGG - Intronic
1087278881 11:96187841-96187863 CAGAGGAGAAGAACAGTAATAGG - Intronic
1087913954 11:103786394-103786416 CAGAGGAGAGGGAGAGAGATGGG + Intergenic
1088567875 11:111192130-111192152 CAGAGGAGAGGGAGAGACATGGG - Intergenic
1089082754 11:115790850-115790872 AAGGGGAAATGGAGAGCATTGGG + Intergenic
1089845548 11:121455284-121455306 CATGGGAGATGGAGAGATAAGGG + Intronic
1091744360 12:2981774-2981796 CAGGGGTGCTGGAGGGTAGTGGG + Intronic
1093687235 12:22070696-22070718 CAGGGAAAATGGGGAGCAATGGG + Intronic
1093711279 12:22333026-22333048 CTGGGGAGGTGGAGAGGAAGGGG + Intronic
1095774704 12:45999606-45999628 AAGGGGAGAGGGAGAGGAAGAGG - Intergenic
1096717175 12:53498700-53498722 CAGAGGAGATGGAGAGAAAGAGG + Intronic
1098047892 12:66420837-66420859 CAGGGGAAATGTACAGTAAGGGG - Intronic
1098826422 12:75303440-75303462 CAGGGGAAATGAATAGTAACTGG + Intronic
1099458463 12:82893942-82893964 CAGAGGAGATGGAGAGAAAAAGG + Intronic
1099571139 12:84320475-84320497 GAGGGGAGATGGATAGCATTAGG - Intergenic
1100046658 12:90390200-90390222 CAGGGGCGATAGAGAGGTATTGG + Intergenic
1100373945 12:93994908-93994930 CAGGAGAGAGGGACAGGAATTGG - Intergenic
1101143179 12:101817056-101817078 CAGTGGGGATGAAGAGTGATTGG + Intronic
1101327790 12:103731874-103731896 CTGGGGAGAGGGAAAGAAATTGG + Intronic
1101728924 12:107410615-107410637 CAGTGGAGATGGGGAGGACTTGG + Intronic
1102172585 12:110853381-110853403 TGGGGGAGATGGAGAGGAGTGGG - Intronic
1102736504 12:115165608-115165630 CAGGGGAGATAGAGAGAGGTTGG - Intergenic
1102768480 12:115452826-115452848 CAGGGGACACGCAGAGTTATGGG - Intergenic
1104394997 12:128425080-128425102 CAGGGGAGAGGGAGAGGTAGTGG + Intronic
1104590827 12:130083619-130083641 ATGGGGAGATGGGGAGTTATGGG + Intergenic
1105580481 13:21691368-21691390 CAGAGGAGATGGAGAAAAACAGG + Intronic
1106948159 13:34851971-34851993 TAGGGGAAATGGAGAGTTATTGG - Intergenic
1107125941 13:36846636-36846658 AAGGGGACATGGAGAATTATTGG + Exonic
1107221302 13:37984486-37984508 CAGGAGAGATCGAGAGCAAATGG + Intergenic
1107629699 13:42330850-42330872 GAGGCGAGATGGAGAGGAAGAGG - Intergenic
1108068900 13:46607172-46607194 CAGAGGAGATGGAAACTACTTGG + Intronic
1108472156 13:50778200-50778222 CAGGGGAGAGAGAGAGCAAAGGG + Intronic
1110046017 13:70831615-70831637 CAGAGGAGAAGGAGAGTCTTAGG + Intergenic
1110261204 13:73487162-73487184 AAGGGGACATGGAAAGTGATGGG + Intergenic
1111669179 13:91306528-91306550 CAGGAGAGAGGGAGAGTGAAGGG - Intergenic
1112383443 13:98915663-98915685 CAGGGAAGGTGGACGGTAATGGG - Intronic
1113159564 13:107364902-107364924 CAGGGGAGAGGGAGAGGGAGAGG - Intronic
1113426065 13:110209611-110209633 CAGGGGAGATGGATTGGTATTGG - Intronic
1113863372 13:113505905-113505927 CACAGGAAAGGGAGAGTAATGGG - Intronic
1113869638 13:113551290-113551312 CAGGGAAGATGGAGTGTCACAGG - Intronic
1114409320 14:22485996-22486018 CAGAGGAAATGGAGAGAGATGGG + Intergenic
1114624388 14:24119356-24119378 CTGGGGAAATGGAGAGCAAGGGG - Intronic
1115141746 14:30179614-30179636 GAGGAGAGATGGAGAGAACTAGG + Intronic
1115392410 14:32867948-32867970 CAGGGTAGATGGAAAATAACAGG - Intergenic
1116170590 14:41396499-41396521 CAGGGGAGAGGGATAGCATTAGG + Intergenic
1117201685 14:53396228-53396250 CAGAGGAGAGGGAGAGAAATGGG - Intergenic
1117207336 14:53457351-53457373 GAGGGGAGATGGATAAAAATAGG - Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117762355 14:59042999-59043021 CAGTGGAGATGCAGAGCAACTGG - Intergenic
1117771326 14:59137009-59137031 TAGGGGAGGTGGGGAGGAATGGG + Intergenic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1119762152 14:77159122-77159144 CAGAGGAGATGGAGACTCAGGGG + Intronic
1119885001 14:78132837-78132859 CAGGGGAGATGCAGAGATATTGG + Intergenic
1120674851 14:87408841-87408863 GGGGGGAGAAGGAGAGTAAAGGG + Intergenic
1121077797 14:91083883-91083905 GAGATGAGATGAAGAGTAATAGG - Intronic
1121170065 14:91846193-91846215 GAGGGCAGTTGGAGAGCAATGGG - Intronic
1121293086 14:92793933-92793955 TAGGGGAGATGGTGAGGAAAGGG + Intergenic
1121827191 14:97019919-97019941 ATGGGGAGATGGGGAGAAATTGG - Intergenic
1122149606 14:99717830-99717852 AAGTGGAGGTGGAGAGGAATGGG - Intronic
1202943762 14_KI270726v1_random:8046-8068 GAGGGGAGAGGGATAGTATTAGG - Intergenic
1124095827 15:26648126-26648148 CAGGGGAGTTGGTGTTTAATGGG - Intronic
1125315384 15:38425970-38425992 TAGGGGAGATGAAGAGAGATTGG + Intergenic
1125329142 15:38565015-38565037 CAGGGGAGTTGGAGAGGAGCGGG + Intronic
1125466696 15:39960358-39960380 CAGGGGAGATAGAGAGGAGAAGG + Intronic
1125880444 15:43189467-43189489 CAGGGGAGATGGGAAGTCATAGG - Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1127697994 15:61470581-61470603 CAGTGGAAATGGAGTGGAATTGG - Intergenic
1128153041 15:65375414-65375436 AAGGGGAGATGGAAGGAAATAGG + Intronic
1128637315 15:69311486-69311508 CAGGGGAGATGGAAACAACTTGG - Intronic
1129236197 15:74225171-74225193 GGGGGGAGATGGAGAGGAAGGGG + Intergenic
1129576756 15:76757265-76757287 GAGGGGAGATGGAGTGATATTGG - Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130939785 15:88497910-88497932 CAGGGGAGAGGTGGAGGAATGGG - Intergenic
1131352977 15:91718373-91718395 CAGGGGACATGGAGAAGAATGGG + Intergenic
1132475051 16:130876-130898 CAGGGGAAATGAAGAGTTATTGG + Intronic
1133604317 16:7371130-7371152 AAGGGCAGAAGGAGAGTAAAAGG - Intronic
1133729355 16:8566673-8566695 GAGGGTTGATGGAGAGAAATAGG - Intergenic
1133818230 16:9214367-9214389 AAGGGGAGATGGGTATTAATTGG - Intergenic
1133866532 16:9649135-9649157 CAGGAGGGATGAAGAGAAATTGG + Intergenic
1134201765 16:12205094-12205116 CAGTGAAGATGGAGAGTCGTGGG + Intronic
1134229179 16:12415879-12415901 CAGGGGAGATGGGGTTTAAGAGG - Intronic
1134385158 16:13764761-13764783 CAGGAGAGAGAGAGAGTAAAGGG + Intergenic
1135166383 16:20142833-20142855 CGAGGGAGGTGGAGAGGAATAGG + Intergenic
1135557217 16:23447069-23447091 CAGTGAAGATGATGAGTAATGGG - Intronic
1135699011 16:24615103-24615125 CAGGGGAGATGGAAAGGGAGTGG + Intergenic
1135769647 16:25207560-25207582 CAGGGCACATGGAGAGTTTTGGG - Intergenic
1137245489 16:46700193-46700215 CAGGGGATGTGGGGAGGAATGGG - Intergenic
1137493312 16:48951108-48951130 CAGGGGAGAGGGAGAGGGAGAGG - Intergenic
1137525667 16:49234087-49234109 GAGGGGAGAGGGAGAGCATTAGG + Intergenic
1137790377 16:51170045-51170067 GATGGGAGATGGGGAGTGATGGG + Intergenic
1137860441 16:51841473-51841495 CAGGGGATATGCTGAGTGATAGG + Intergenic
1138929374 16:61633660-61633682 CAGAGAAGATGGAGAGGAACTGG - Intergenic
1139471957 16:67183223-67183245 AAGGGGAGATGGAGGGGACTGGG - Intronic
1141619178 16:85227765-85227787 CCTGGGAGATGGAGATTGATGGG + Intergenic
1141782464 16:86172608-86172630 GAGGGGAGATGGAGGATAAAAGG - Intergenic
1142470542 17:161101-161123 CTGGGGAGATGGGGAGAGATGGG - Intronic
1143168455 17:4911353-4911375 AGGGGGAGATGGAGAGAAAGAGG + Intergenic
1144118496 17:12125989-12126011 CAGGGGAGAGAGAGAGTGAAGGG + Intronic
1144356570 17:14452221-14452243 TGGGGGAGATGGAGAGTGAGGGG + Intergenic
1144729158 17:17516845-17516867 GAGGGCAGCTGGAGAGTAAGGGG - Intronic
1145272044 17:21410019-21410041 GAGGGGAGAGGGAGAGTGGTGGG - Intronic
1145310253 17:21697482-21697504 GAGGGGAGAGGGAGAGTGGTGGG - Intronic
1145857965 17:28180883-28180905 AAGGAGAGGTGGAGAGTGATGGG - Intronic
1145886217 17:28384241-28384263 CAGGGCAGATGGAGAGACTTTGG + Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146949314 17:36894697-36894719 CAGTGGTGATGGAGAGTGTTGGG - Intergenic
1147042925 17:37731844-37731866 GAGGGGAGATGGTGAGTGAGGGG + Intronic
1147062013 17:37887596-37887618 TAGTGGAGATGGAGAGAGATAGG - Intergenic
1147575118 17:41594560-41594582 GAGGGAGGATGGAGAGTAAGAGG + Intergenic
1148466065 17:47866038-47866060 CAGGGGAGATGATGAAAAATTGG - Intergenic
1149389190 17:56172646-56172668 CAGGGGAGCTGCCAAGTAATTGG + Intronic
1150295164 17:64003496-64003518 CAGGGAAGAGGGAGAGTAAGAGG + Intronic
1150672936 17:67217827-67217849 CAGGGGAGATTGGGAATATTGGG - Intronic
1151510354 17:74555166-74555188 GAGAGGAGAGGGAGAGTGATGGG + Intergenic
1152262618 17:79275161-79275183 CAGGGGAGGGGGAGAGAGATAGG - Intronic
1152816278 17:82410018-82410040 CAGGAGAGATGGGGAGCAGTGGG - Intronic
1152885209 17:82845438-82845460 CAGACGAGATGGAGAGGAAGGGG - Intronic
1153267648 18:3286609-3286631 CAGGTGGGATGGAGAGTGAAGGG + Intergenic
1153935348 18:9914999-9915021 CCGGGGAGGTGGAGAGTCCTTGG + Intronic
1154473184 18:14724633-14724655 CAGTGAAGATGCAGAGGAATTGG - Intergenic
1156139605 18:34090873-34090895 CAGGGGTGGTGCAGAGAAATAGG + Intronic
1156220896 18:35051058-35051080 ATTGGGAGATGGAGTGTAATGGG + Intronic
1156600477 18:38599742-38599764 AGAGGGAGATGGAGAGTAAATGG + Intergenic
1156851967 18:41739083-41739105 CAGGGGAGAGGGAGTGAGATGGG - Intergenic
1156912434 18:42426434-42426456 AAGAGGAGATGGAGAATAAAGGG - Intergenic
1156920985 18:42522116-42522138 CAGTGGAGATGAAGAGTAATAGG - Intergenic
1157312881 18:46565428-46565450 CAGGGGAGACAGACAATAATAGG - Intronic
1157477559 18:48033155-48033177 CAGGGCAGATGGAGAGAATCTGG + Intronic
1159626383 18:70700149-70700171 AAGGGGAGATGGAGAGAAGCTGG - Intergenic
1159789028 18:72753069-72753091 AAGGAGAGATGGAAAGTAACAGG + Intronic
1161249195 19:3271239-3271261 CAGGGGAGGTGGGGAGAGATGGG - Intronic
1161443060 19:4303442-4303464 CTGGGGAGATGGAGATTACAGGG + Intergenic
1161585335 19:5102547-5102569 CAGGGGAGCAGGGGAGGAATGGG + Intronic
1162614186 19:11783764-11783786 AAGGGGAAATGAAGAGAAATTGG + Exonic
1163091509 19:15023189-15023211 CAGGGGAGAGGGAGGGCCATGGG - Exonic
1163115170 19:15184862-15184884 CAGAGGAGATGGAGAGGAGGAGG + Intronic
1164423235 19:28116332-28116354 GAGGGGAGATGGATAGCATTAGG - Intergenic
1165339901 19:35204046-35204068 CAGGGGAGCTGGAGATTGAAGGG - Intergenic
1166305546 19:41935134-41935156 CAGGGGAGAGGGAGAGAGAGAGG + Intergenic
1167608880 19:50496692-50496714 CAGGGGAGAAGGAGAGTCTGAGG + Intergenic
1168165467 19:54544207-54544229 CAGGGGGTATGGAGAGCATTAGG - Intronic
925530106 2:4850011-4850033 CAGGAGAGAGGGAGAGTGAAAGG + Intergenic
925694426 2:6560670-6560692 CAAGTGAGAAGGGGAGTAATGGG + Intergenic
926449977 2:12991213-12991235 CAGAGGAGAGGGAGAGAGATGGG - Intergenic
926604640 2:14885251-14885273 GAGTAGAGATGGAGAGAAATGGG + Intergenic
926615742 2:14995190-14995212 CAGGGGGGAGGGATAGTATTAGG - Intergenic
927198859 2:20566236-20566258 CGGGGGAGATGGGCAGTTATAGG - Intronic
927375205 2:22405364-22405386 CAGGGGAGATGGGAAGAAACAGG + Intergenic
928261636 2:29772677-29772699 GAGAGGAGATGGAGGGTAAGGGG + Intronic
928814007 2:35267545-35267567 CAGGGGAAAGGGAGAGAAGTTGG - Intergenic
929097615 2:38278842-38278864 CTGAGGAGAGGGAGAGTGATGGG + Intergenic
929441025 2:41965881-41965903 AAGGGGAGAGAGAGAGAAATGGG + Intergenic
929749967 2:44700554-44700576 CTGGGGAGAGGGAGAGAGATGGG + Intronic
929811215 2:45190688-45190710 ATGGGGAGATGGAGAGCAACAGG - Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
929972539 2:46595252-46595274 AAGGAGAAATGGAGAGTGATTGG - Intronic
930586636 2:53275313-53275335 CAGGGCAGGGGGAGACTAATGGG - Intergenic
930881887 2:56279434-56279456 CAGGGGTGAAGGGGAGAAATAGG - Intronic
931083021 2:58796895-58796917 CAGTGGAGAGGGAGAGGAAAAGG - Intergenic
931289275 2:60858117-60858139 CAGGGGAAATGGAAATTAAGGGG + Intergenic
931842444 2:66168595-66168617 CAGGGGAGTTGCAGTGTAAGTGG + Intergenic
932055070 2:68435018-68435040 CATGGGAGATGGGGAGAAAAAGG + Intergenic
932165082 2:69498501-69498523 CAGGGGAGGTGGGGAGAAAGAGG - Intronic
932168589 2:69532331-69532353 CACAGGAGATGCAGAGTAAGAGG + Intronic
932207142 2:69893214-69893236 CTGGGGAGAGGGAGAGCATTGGG + Intergenic
932720531 2:74135879-74135901 CTGGGGAGATGGACAGGTATAGG - Intronic
932732335 2:74230247-74230269 CAAGGGAAAGGGAGAGTGATGGG + Intronic
932819934 2:74890966-74890988 CAGGGAAGAAGGAGAGAAAGAGG - Exonic
933585994 2:84179982-84180004 AAGGGGAGATGGAAAGAAAAAGG + Intergenic
934087901 2:88525509-88525531 CAGGGAAGATGGGGAGGAGTGGG + Intronic
934720276 2:96569874-96569896 CAGGAGAGAGAGAGAGTGATGGG + Intergenic
935225204 2:101046943-101046965 GAGGGTAGTTGGAGAGTGATGGG - Intronic
936083205 2:109449230-109449252 CAGGCGGGATGGAGAGTTCTGGG - Exonic
936574419 2:113641530-113641552 CAGGTGTGATGGAGAGAACTGGG + Intronic
936673688 2:114689208-114689230 CATGGGAGAGGGAGAGCATTAGG - Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937154575 2:119709990-119710012 AAGGGGAAATGGGGAGTAACTGG + Intergenic
938558795 2:132451264-132451286 GAGTGGAAATAGAGAGTAATGGG - Intronic
939057135 2:137379549-137379571 AAGGGGAGAAGGAAAGCAATTGG + Intronic
939928814 2:148206587-148206609 GAGGGGAGATGGAGAGAGACTGG - Intronic
939933665 2:148261907-148261929 TAGGGGAGAGGGAGAGAGATGGG + Intronic
940848661 2:158667477-158667499 CAGGGGAGAAGGAGGGGAAATGG + Intronic
941055511 2:160783517-160783539 GAGAGGAGATGGAAAATAATGGG - Intergenic
943115878 2:183669555-183669577 CAGGGGCTAGGAAGAGTAATAGG + Intergenic
943597769 2:189878582-189878604 AAGGGGAAATGGAGAGTCAGGGG - Intergenic
943748385 2:191486106-191486128 CAAGGGAAATGGAGAGGAGTGGG - Intergenic
944529572 2:200653999-200654021 CTGAGGAGAGGGAGAGAAATGGG - Intronic
945712767 2:213320532-213320554 AAGGGGAGATGAAGAGAAATTGG - Intronic
946950699 2:224871398-224871420 CAAGGGAGAAGGAGAGAAATGGG - Intronic
947971977 2:234332351-234332373 CAGGACAGATAGAGAGAAATGGG - Intergenic
1168731422 20:85020-85042 CAAGGGAGATAGAGAGTAGAAGG - Intergenic
1169184981 20:3607365-3607387 CTGGGGAGATAGAGGTTAATGGG - Intronic
1169485196 20:6024495-6024517 CTGAGGAGAGGGAGAGTGATAGG - Intronic
1169843492 20:9965140-9965162 CAGAGGAGATGAGGAGAAATGGG + Intergenic
1171796246 20:29568704-29568726 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1171851991 20:30315463-30315485 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1172554889 20:35832253-35832275 AAGGGGAGAGGGAGAGGAAGGGG - Intronic
1173326012 20:42034413-42034435 AAGGGGAGAGGGAGACTATTAGG + Intergenic
1174052865 20:47779418-47779440 CAATGGAGATGGAGTGAAATGGG - Intronic
1175110523 20:56644843-56644865 CAGGGGAAGTGGAGAGTAGGGGG + Intergenic
1175238253 20:57527121-57527143 CAGGGGTGATGGAGATTGACAGG + Intergenic
1176801300 21:13433216-13433238 CAGTGAAGATGCAGAGGAATTGG + Intergenic
1177352216 21:19958807-19958829 GAGGGGAGAGGGATAGTATTAGG - Intergenic
1177709612 21:24755855-24755877 CAAGGGAGAGGGAGAGAAACAGG - Intergenic
1178297655 21:31423875-31423897 CAAGGGAGTTGGGGAGAAATAGG + Intronic
1178764765 21:35439969-35439991 CAGGGGAGCTGGAGTGTGGTAGG - Intronic
1180845100 22:18976470-18976492 CAGGAGAGATGCAGAGCACTAGG - Intergenic
1181660991 22:24348636-24348658 AAGGAGAGATGCAGAGTATTTGG - Intronic
1183341004 22:37281483-37281505 CATGGGGCCTGGAGAGTAATGGG + Intergenic
1183612553 22:38920018-38920040 CAGGGCAGAGGGAGAGAGATGGG + Intergenic
1183700297 22:39447345-39447367 GAGGGCAAATGGAGAGTAACTGG + Intergenic
1183745482 22:39689245-39689267 CAGGGGAGAGGAAGAGGATTTGG - Exonic
1184813919 22:46856063-46856085 CAGGGGACATGCAGAGGAAAGGG - Intronic
1185096933 22:48814003-48814025 CAGAGGAGAGGGAGAGAGATGGG - Intronic
949323437 3:2837774-2837796 GAGGGAAGATGGAGAGTCAGTGG + Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
951549144 3:23859405-23859427 CAGGTAATATGGAGAGTCATGGG - Intronic
951563086 3:23987503-23987525 CAGGAGAGGTGGAGAGTGAAGGG - Intergenic
952113405 3:30150885-30150907 CTTAGGAGAGGGAGAGTAATAGG - Intergenic
952351842 3:32546793-32546815 CAGGAGAGATGGTGAGAAAATGG + Intronic
952855255 3:37764923-37764945 CAAATGAGATAGAGAGTAATGGG - Intronic
952861467 3:37816196-37816218 CAGGTGAGATGCTGAGTACTGGG + Intronic
953085572 3:39663266-39663288 CAGGGCAGAGGGAGAGCATTTGG + Intergenic
953267063 3:41400814-41400836 TAGGGGAGATGCTGAGAAATTGG - Intronic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953623363 3:44551282-44551304 CAGGGGAGAGAGAGAGCAAAGGG + Intergenic
953701562 3:45199861-45199883 CAGGAGAGCTGGAGAGTTTTTGG - Intergenic
955053455 3:55434755-55434777 CTGGGGAGATGGGCAATAATTGG + Intergenic
955106403 3:55902779-55902801 CAGGTGAGAAGCAGAGTAACTGG - Intronic
955521236 3:59777552-59777574 TAGTGGAGGTGGAGAGAAATAGG - Intronic
956014251 3:64864500-64864522 GAGAGGAGATGGAGAATAACAGG + Intergenic
957149274 3:76464002-76464024 GAGGAGAGAAGGAGAATAATAGG + Intronic
957210360 3:77250769-77250791 CATGAGAGATGGAGGGTAAGGGG + Intronic
957487888 3:80886652-80886674 AAGGGGAGAAGGACAGTAATAGG - Intergenic
957648062 3:82960190-82960212 CAGGGGAGATGGGGTGTGGTGGG + Intergenic
957856032 3:85879995-85880017 CAGGGGCGATGGAGAGTAGAGGG - Intronic
958133442 3:89458653-89458675 CAGCGAAGATGCAGAGAAATAGG - Intronic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
960702198 3:120450323-120450345 CAGAGGAGACTGAGAGTAGTTGG - Intronic
960929544 3:122831606-122831628 GCTGGGAGATTGAGAGTAATGGG + Intronic
961350761 3:126300513-126300535 CAGGGGAGATGGGGAGCCATGGG - Intergenic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963024434 3:140904759-140904781 CAGTGGAGATGGTGAGAACTGGG + Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
964128633 3:153263429-153263451 CAGGGAAGATACAGAGAAATAGG + Intergenic
965238139 3:166155855-166155877 GAGGGGGGATGGAAAGTATTAGG - Intergenic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966642206 3:182203901-182203923 GAGGTGAGATGGAGAGGAAGTGG - Intergenic
966752620 3:183336919-183336941 GAGGGGTGGTGGAGACTAATTGG - Intronic
967899647 3:194436331-194436353 GGGGGGACATGGAGAGTACTGGG + Intronic
968195379 3:196702174-196702196 CAGGGGAGATGGTGAGGATGGGG + Intronic
969207355 4:5656872-5656894 CAGGTGAGAGGGAGAGGGATAGG - Intronic
970990348 4:22206605-22206627 CAGGGGGGAGGGATAGTATTAGG - Intergenic
971856889 4:32055346-32055368 CAGGAGAGAGAGAGAGTAAAGGG + Intergenic
972649107 4:40999162-40999184 CAGGTGTGATGCAGAGTAGTAGG - Intronic
972988128 4:44790811-44790833 CAGGGGAGATGAAGAGGGGTTGG - Intergenic
975023818 4:69524398-69524420 CAGAGGAGAGGGAGAGAGATGGG + Intronic
975110373 4:70616850-70616872 GAGGAGGGATGGAGAGTAGTAGG + Intergenic
975878438 4:78871518-78871540 AAGGGGAGATTTAGTGTAATGGG + Intronic
976514867 4:85953751-85953773 CAGGGCAGAGGGAGACTCATAGG + Intronic
976681193 4:87757961-87757983 AAGGGGAGAGGGAGAGAAAGGGG + Intergenic
976834590 4:89356762-89356784 CAGGGGAGACGGAGAGGGAGAGG - Intergenic
977145488 4:93434657-93434679 GAGTGGAAAGGGAGAGTAATTGG - Intronic
978299848 4:107255515-107255537 TAGGGGAGATGGTGAGGAAGTGG + Intronic
978645394 4:110925079-110925101 CAGCAGAGATGGAGAGAAACTGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980627490 4:135391933-135391955 GAGGGGAGCTGGAGAGTGAATGG + Intergenic
980680647 4:136155414-136155436 GAGGGGAGCTGGAGAGTAGGCGG + Intergenic
981547079 4:145904417-145904439 CAGGGAGGATGGGGAGTAATGGG + Intronic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
982520660 4:156412641-156412663 CGGAGGAGAGGCAGAGTAATGGG + Intergenic
983672143 4:170250116-170250138 CATGGCAAATGGAGAGAAATGGG + Intergenic
984677636 4:182568513-182568535 CAGGCAGGATGTAGAGTAATTGG + Intronic
985451255 4:190065201-190065223 GAGGGGAGATGGGGAGACATTGG + Intergenic
987695731 5:21328957-21328979 CAGTAAAGATGGAGAGAAATAGG + Intergenic
989125539 5:38049108-38049130 CAGGGGAGTGGGAGAGGAGTGGG + Intergenic
989459491 5:41681244-41681266 CAGGGTAGATTGAGAGATATTGG + Intergenic
989532380 5:42523618-42523640 CAGAGGAGAGGGAGAGAGATAGG - Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991487968 5:67157621-67157643 CAGGAGAGATGGAGAGGACTGGG + Intronic
991744670 5:69723135-69723157 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991753033 5:69832098-69832120 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991796241 5:70302859-70302881 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991802651 5:70388825-70388847 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991824052 5:70598449-70598471 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991832353 5:70707217-70707239 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991888619 5:71302418-71302440 CAGTAAAGATGGAGAGAAATAGG - Intergenic
992040584 5:72827004-72827026 GAGAGGAAATGGAGAGTAAAGGG + Intronic
992351966 5:75939362-75939384 CAGGGGAGAGGGAGAGACAGAGG + Intergenic
993495096 5:88599974-88599996 CAGGGAAGGTGGAGAGGAGTGGG + Intergenic
993512280 5:88786001-88786023 CAAGGAAAATGGAGAGGAATAGG - Intronic
993538562 5:89119276-89119298 CTGGGAAGATGAAGAGGAATTGG + Intergenic
993787316 5:92159265-92159287 CTGAGGAGATGGAGAGTGGTGGG - Intergenic
993805719 5:92406656-92406678 CTAAGGAGATGGAGAGAAATGGG - Intergenic
993905227 5:93615375-93615397 CAGGTGAAATGGACAGGAATGGG + Intergenic
993930142 5:93927824-93927846 GAGGGGAGAGGGAGAGAAAAGGG + Intronic
995390059 5:111630479-111630501 AAGGGGGGATGGAGAGAAAAAGG + Intergenic
995693989 5:114859186-114859208 CATGGCTGATGGAAAGTAATAGG + Intergenic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
997231793 5:132250857-132250879 CAGGGAAGATGAAGAGAAAATGG - Intronic
998104066 5:139457208-139457230 CAGGTGGGGTGGAGAGTAGTGGG - Intronic
998136468 5:139676849-139676871 AAGGGGAGCTGGAGAGGAAGGGG - Intronic
998271884 5:140713950-140713972 GAAGGGAGATGGAGAGTTAGTGG - Intergenic
998887995 5:146714823-146714845 CAGGGGAGAGGGAGAGAATAAGG - Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
1000129270 5:158279743-158279765 CTGAGGAGATGGAGAGAGATGGG - Intergenic
1000452892 5:161412395-161412417 CAGTGGAGATGGTAAGGAATCGG - Intronic
1001025714 5:168222769-168222791 CATGTCAGATGGTGAGTAATAGG - Intronic
1001284385 5:170411913-170411935 CAGGGTAGATGGAGAGAGAGAGG + Intronic
1001330903 5:170761720-170761742 AAGGGGAGAGGGAGAGGAAGTGG - Intergenic
1001728070 5:173924747-173924769 CATGGAAGATGCAGTGTAATGGG - Intronic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1003146565 6:3514958-3514980 CAGGGATGATGGAGGGGAATTGG + Intergenic
1003426824 6:6003362-6003384 CAGGGGAGGAGGAGAGAAAGAGG - Intronic
1003634015 6:7814828-7814850 CAGGGGAGGGGGAGAGCATTAGG + Intronic
1005555054 6:26969109-26969131 CAGTAAAGATGGAGAGAAATAGG - Intergenic
1005613557 6:27550397-27550419 CAGGGGAAATGGGGACTTATTGG - Intergenic
1006497134 6:34431870-34431892 CTGTGGTGATGGAGAGTAATGGG + Intergenic
1007550303 6:42724207-42724229 TTGGGGAGATGGAGAATAATGGG - Intergenic
1007755649 6:44097526-44097548 CAAGGGAGATGGAGAGCCAGTGG + Intergenic
1007818454 6:44541848-44541870 CAGGGGAGAGGGGCAGTAAGTGG + Intergenic
1007995756 6:46306115-46306137 CAGGGGATATGGTGAGGAGTAGG + Intronic
1009815011 6:68721487-68721509 CAGGGGGGAGGGATAGTATTAGG + Intronic
1010883621 6:81210323-81210345 GAGGGGGGATGGATAGTATTAGG + Intergenic
1011863474 6:91791266-91791288 GAGGGGAGAGGGATAGTATTAGG - Intergenic
1012117089 6:95314674-95314696 CAGGGGAGTGGGAGAGGAATTGG + Intergenic
1012464734 6:99504536-99504558 CAGAGGATCTGGAGAGAAATGGG + Intronic
1012583759 6:100898487-100898509 CAGGGGAGATAGGGCGTAAGTGG + Intergenic
1014023428 6:116616892-116616914 CAGGGGAGAAGGAGAGGAAGAGG - Exonic
1014137321 6:117905433-117905455 CAGAGGAGATGTAGAGCATTTGG + Intergenic
1014786713 6:125627738-125627760 TAGGGGAGATGGAGGGTAAGAGG + Intergenic
1015007027 6:128296028-128296050 CAGAGGCCATGGAGAGTCATTGG - Intronic
1015331732 6:131987811-131987833 CAGGGGAAATGGAAATCAATTGG + Intergenic
1015857832 6:137644569-137644591 GGGGGGAGATGAAGAGAAATGGG - Intergenic
1015906633 6:138123647-138123669 CAGAGAAGATGGAGAGGGATGGG - Intergenic
1015918623 6:138244288-138244310 CAAGGAAGATGGAGAGAAAATGG - Intronic
1016666541 6:146648536-146648558 CAGGAGAGAGGGAGAGTAAAGGG + Intronic
1017043464 6:150325920-150325942 CAGGGGAGGTGGTGAGAAGTGGG + Intergenic
1017243727 6:152198687-152198709 CAGAGGAGAAGGAGAGAGATTGG + Intronic
1018291456 6:162296111-162296133 GAGGGGAGAGGGACAGTAAATGG + Intronic
1018921614 6:168179705-168179727 CAGGGGAATTGGAGGGGAATTGG + Intergenic
1018994578 6:168701296-168701318 CAGGGGAGAGGCGGAGAAATGGG - Intergenic
1020026840 7:4905435-4905457 AAGGGAAGAAGGAGAGGAATGGG + Intergenic
1020431822 7:8123258-8123280 CTGGGGAAATGGAGAGGAAGGGG - Intronic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022483962 7:30763506-30763528 CAGGGGAGAGGGAGAGCAAGAGG + Intronic
1022594545 7:31699954-31699976 CAGGGGAGAGGGAGAGAGATAGG - Intronic
1022729604 7:33010082-33010104 CAGGGAAGATGGAGAGGAATAGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1024354567 7:48401425-48401447 CACAGGAGATGGTGAGTTATTGG - Intronic
1024454638 7:49589896-49589918 CAGTGGAGATGTAGAGAAATTGG + Intergenic
1024851384 7:53721242-53721264 CATGGGAGGTGGAGGGTAGTGGG + Intergenic
1025978131 7:66385759-66385781 CAGGAGAGAGGGAGAGAATTAGG - Intronic
1026257682 7:68726667-68726689 CAGGGGAGATGGAGACTTCGGGG - Intergenic
1027271291 7:76520548-76520570 CAGGGATGATGGAGAGAAATGGG - Intergenic
1027321055 7:77010483-77010505 CAGGGATGATGGAGAGAAATGGG - Intergenic
1027691903 7:81358151-81358173 AAGGAGAGAGGGAGAGAAATAGG - Intergenic
1028255973 7:88598079-88598101 CAGGGTATAAGGAGAGTATTTGG + Intergenic
1028258698 7:88633406-88633428 GAGGGGGGATGGATAGTATTCGG + Intergenic
1028297609 7:89154704-89154726 CAGAGGCTAGGGAGAGTAATGGG + Intronic
1028768606 7:94589341-94589363 CAATGGAGATGGGGAGGAATGGG - Intronic
1028835733 7:95373111-95373133 TAGGGGACATGGAGAGGAAGTGG - Intronic
1029256469 7:99273013-99273035 CATGGGATTTGGAGACTAATGGG + Intergenic
1031269792 7:119634168-119634190 GAGGGGAGATGGATAGCATTGGG - Intergenic
1033235817 7:139637107-139637129 CAGGGGGGATGGAGAATCAGGGG - Intronic
1033962802 7:146934459-146934481 AAGGGGGGAGGGAGAGCAATAGG + Intronic
1034309596 7:150075340-150075362 GAAGGGAGATGAAGAGAAATAGG - Intergenic
1034797263 7:154025301-154025323 GAAGGGAGATGAAGAGAAATAGG + Intronic
1035739345 8:1914405-1914427 CAGGGGCCAGGGAGAGAAATCGG - Intronic
1036787333 8:11696990-11697012 CCGGGGAGATGGTGTGAAATAGG + Intronic
1040109111 8:43558405-43558427 CGGGGGAGAAGGAGGGTTATAGG + Intergenic
1041314705 8:56549160-56549182 GAGGGGAGAGGGAGAGCATTAGG - Intergenic
1041669090 8:60475290-60475312 AAGGGGAGATGAAGAGGAAGAGG - Intergenic
1042612137 8:70610731-70610753 GAGGGGAAATGGAGAGTTACTGG - Intronic
1042882413 8:73508359-73508381 CTGAGGAGATGGAGAGAGATGGG + Intronic
1042943452 8:74130964-74130986 CTGGGGAGATGGAGAGAGTTGGG + Intergenic
1043183025 8:77108712-77108734 GAGGGGAGATGGATAGCATTAGG + Intergenic
1043658274 8:82701399-82701421 GAGGGGAGAGGGATAGTATTAGG - Intergenic
1043714354 8:83462840-83462862 AAGGGGAGGAGGAGAGAAATAGG - Intergenic
1044604819 8:94039433-94039455 CAGTGGAGATGGAGAGAGATGGG + Intergenic
1045172590 8:99687249-99687271 GAGAGGAGAGGGAGAGTAAAGGG - Intronic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1046424025 8:114022741-114022763 CTGAGGAGAGGGAGAGAAATGGG + Intergenic
1046599093 8:116297005-116297027 CAGGGGAGAGGGAGAGGGAGAGG - Intergenic
1047438889 8:124858802-124858824 CAGAGGTGATGGAGAGGAAGTGG - Intergenic
1047703625 8:127474902-127474924 CAGAGGAGATGGGGAGAGATGGG - Intergenic
1047939777 8:129818086-129818108 CAGGAGAGATGGAGAGATGTAGG - Intergenic
1048065140 8:130960114-130960136 CAGTGGAGATGGAGAAACATGGG + Intronic
1049032021 8:140045115-140045137 CAGCAGAGATGGAGAGGAAAAGG + Intronic
1049056369 8:140240442-140240464 CAGGTGAGCTGGAGAGCAAGAGG - Intronic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1050792584 9:9493010-9493032 CTGAGGAGAGGGAGAGTGATGGG - Intronic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1051521064 9:17988924-17988946 CATGGGAAAGGGAGAGCAATTGG - Intergenic
1053321824 9:37105437-37105459 CAGAGGGGAAGGAGAATAATGGG - Intergenic
1053789774 9:41678717-41678739 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1054155367 9:61636036-61636058 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054178114 9:61890407-61890429 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1054475153 9:65567147-65567169 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054659415 9:67690417-67690439 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054914706 9:70485324-70485346 CAGGAGAGAGAAAGAGTAATGGG + Intergenic
1055124400 9:72702592-72702614 CAAGAGAGATGGAGAGAATTTGG + Intronic
1055607168 9:77982807-77982829 GAGGGGGGAGGGATAGTAATGGG + Intronic
1055722080 9:79186321-79186343 CAGGGGAAAAGGAGAGTCAGAGG - Intergenic
1056505051 9:87250531-87250553 CAGGAGAGATGGTAAGTGATGGG + Intergenic
1057627666 9:96692171-96692193 CAGGCTATATGGAAAGTAATGGG + Intergenic
1057992902 9:99790807-99790829 TAGGGGAGATAAAGAGAAATTGG - Intergenic
1058880827 9:109284832-109284854 CAGTGGCAATGGATAGTAATAGG - Intronic
1059746942 9:117211474-117211496 CAGGAGAGAGAGAGAGCAATGGG - Intronic
1060228800 9:121812388-121812410 CAGGGTAGCTGGAGAGGACTTGG + Intergenic
1060424982 9:123496964-123496986 CAGGGGAGATAGGGAGTGGTGGG - Intronic
1060956829 9:127647589-127647611 CAGAGGAGATGGTGAGAAGTGGG - Intronic
1061261088 9:129481547-129481569 CAGCGGAGGTGGGGAGTAAAAGG + Intergenic
1061271281 9:129544840-129544862 CTGGGGAGGTGGAGAGTAGGAGG - Intergenic
1061390342 9:130314227-130314249 GAGGGGAGTTGGGGAGAAATGGG + Intronic
1062145428 9:134986854-134986876 CAGGGGAGAGGGATAGCATTAGG + Intergenic
1203618247 Un_KI270749v1:89715-89737 GAGGGGGGAGGGAGAGTATTAGG + Intergenic
1186200514 X:7151307-7151329 CAGCGTAGATGGAGGGTAACAGG + Intergenic
1187297842 X:18019504-18019526 GAAGGGAGATAGAGAGTAAAAGG - Intergenic
1188103919 X:26125263-26125285 CAGGAGAGAGAGAGAGCAATGGG + Intergenic
1189181420 X:39008250-39008272 AAGGGGAGAGGGAGAGAAAGGGG + Intergenic
1189369093 X:40413667-40413689 CAGGGGTGACGTAGGGTAATGGG + Intergenic
1190467139 X:50736390-50736412 CTGGGGAGATGGAGAGCGTTAGG - Intronic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191801659 X:65087522-65087544 CAGGGGCGATCGAGAGTCAAAGG + Intergenic
1192447837 X:71223905-71223927 CATGGGAGATGGGGAAGAATTGG - Exonic
1193951572 X:87807302-87807324 TAATGGAGATGGAGAGTAATAGG - Intergenic
1194595887 X:95856722-95856744 CGGGGGAGGTGGGGATTAATGGG + Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195430210 X:104780689-104780711 CATGGCAGATGGAGAAAAATAGG - Intronic
1195499468 X:105578011-105578033 GAGGGGAGAGGGATAGTATTAGG - Intronic
1198134673 X:133736718-133736740 CAGGGGAGATGGAGAGTAATAGG + Intronic
1199599859 X:149535464-149535486 GAAGGGAGAAGGAGAGAAATAGG - Intergenic
1199650785 X:149944805-149944827 GAAGGGAGAAGGAGAGAAATAGG + Intergenic
1199896961 X:152135807-152135829 CAGGGGACAGGGAGAGCAAGAGG - Exonic
1200020238 X:153197855-153197877 CAGAGGAGAGGGAGAGGCATGGG - Intergenic
1200046647 X:153406505-153406527 GAAGGGACATGGAGAGTACTGGG + Intergenic
1200302793 X:154995299-154995321 TTGGGGAGAGGGAGAGTAAATGG + Intronic
1200771518 Y:7129946-7129968 AGGGGGAGATGGATAGCAATAGG - Intergenic
1201606648 Y:15792953-15792975 AAGGGGAGAGGGAGAGAAACAGG - Intergenic
1201663801 Y:16426790-16426812 TAGGGAAGAAGGAGAGAAATGGG - Intergenic