ID: 1198137308

View in Genome Browser
Species Human (GRCh38)
Location X:133766788-133766810
Sequence CATTATGTCCATCTTCTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 344}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198137306_1198137308 -10 Left 1198137306 X:133766775-133766797 CCAATATTTTTTCCATTATGTCC 0: 1
1: 0
2: 3
3: 41
4: 461
Right 1198137308 X:133766788-133766810 CATTATGTCCATCTTCTTCAAGG 0: 1
1: 0
2: 0
3: 26
4: 344
1198137305_1198137308 -1 Left 1198137305 X:133766766-133766788 CCTATTTGTCCAATATTTTTTCC 0: 1
1: 0
2: 2
3: 47
4: 588
Right 1198137308 X:133766788-133766810 CATTATGTCCATCTTCTTCAAGG 0: 1
1: 0
2: 0
3: 26
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198137308 Original CRISPR CATTATGTCCATCTTCTTCA AGG Intronic
900841876 1:5056505-5056527 CATTATTTCATTCTTTTTCATGG - Intergenic
900896971 1:5490048-5490070 CATGATGTCCTTCTTCTTTATGG - Intergenic
902033897 1:13442535-13442557 TATTATTTTCATCTTCTTCATGG + Intergenic
902038623 1:13475923-13475945 CATCATCTCCAGCTTCTTCCTGG - Exonic
902668834 1:17957947-17957969 CATTCTATCTTTCTTCTTCAAGG + Intergenic
905378606 1:37543490-37543512 CATTATCTCATTCTTTTTCATGG - Intronic
906705355 1:47890781-47890803 AATTATATTCTTCTTCTTCAGGG - Intronic
906800422 1:48732413-48732435 CTTTATGAGCATCTTGTTCAGGG - Intronic
908883905 1:68765770-68765792 CATTATTTCATTCTTCTTTATGG - Intergenic
908935598 1:69372573-69372595 CATTCTCTCCATCTCTTTCAAGG + Intergenic
909196923 1:72638818-72638840 CATTATGCCAATTTTTTTCATGG - Intergenic
909667872 1:78155631-78155653 CAGTATATGCATCTTTTTCATGG - Intergenic
909691702 1:78414728-78414750 CATTTTCTCCATTTTCTGCAGGG + Intronic
912071050 1:105810037-105810059 CATTTTCTCCAGCTTCATCAAGG + Intergenic
912171549 1:107106687-107106709 TATTATGTTCATCATCATCATGG + Intergenic
912897179 1:113604643-113604665 CATTATTTCATTCTTTTTCATGG - Intronic
914665385 1:149828461-149828483 CATTATGTCCAGCTGGTTCCGGG - Intergenic
914670380 1:149865333-149865355 CATTATGTCCAGCTGGTTCCGGG + Intronic
916227209 1:162500409-162500431 CATTATGTCCTTTTTTTACACGG - Intronic
916848251 1:168675522-168675544 CAACATTTCCATCTTCTTCTAGG + Intergenic
917431639 1:174975448-174975470 CCATATTTCCATTTTCTTCATGG + Intronic
918450518 1:184653207-184653229 CATTATCTCCATCTTAAACAAGG - Intergenic
918583161 1:186156213-186156235 CATTTTTTACAACTTCTTCATGG + Intronic
918668853 1:187187397-187187419 CATGATATCCTTCTTTTTCATGG - Intergenic
919057068 1:192584450-192584472 CATTATGTCATGATTCTTCATGG + Intergenic
919917349 1:202146987-202147009 CCTTCTTTCCATCTTCTTCTTGG - Intergenic
920849085 1:209616475-209616497 CATCCTGTCCATCATCTCCATGG + Exonic
920918113 1:210274918-210274940 CATTTTGTCTAACTTCTTTAAGG - Intergenic
921502095 1:215917107-215917129 CATTATGACCACCAACTTCAGGG - Intronic
921609847 1:217198704-217198726 CCTTCTGTCCATCTTCTAGAGGG + Intergenic
924450077 1:244170301-244170323 CAGGATTTCCATCTTTTTCAAGG + Intergenic
1064299172 10:14107017-14107039 CATGATTTCAATCTTTTTCATGG - Intronic
1065796999 10:29317004-29317026 CATCATGTCCAGCCTCTTCCAGG + Intronic
1065800796 10:29350085-29350107 CATTTTGTCCATTTTCTACTGGG - Intergenic
1066070104 10:31799618-31799640 CTTTAAGTCCATCTTCTCCAAGG + Intergenic
1067234177 10:44434655-44434677 GATTATGTCCTTTGTCTTCAGGG + Intergenic
1068285475 10:54928547-54928569 CATTTTCTCCATCTCTTTCAGGG + Intronic
1068603250 10:58977910-58977932 AATTTTGTCCGTCTTGTTCATGG - Intergenic
1069332890 10:67314095-67314117 AATTATGTGCATCTTCTTTTTGG - Intronic
1069938340 10:71935240-71935262 CATTATTTCATTCTTTTTCATGG + Intergenic
1072036069 10:91563880-91563902 CAGTGTGTCCATCTTCTCAAAGG + Intergenic
1072042335 10:91620139-91620161 CACTATGTTCCTCATCTTCAAGG + Intergenic
1072600233 10:96919458-96919480 AATTATTTGCATTTTCTTCATGG + Intronic
1072846432 10:98836446-98836468 CTTTTTGTCAATCTCCTTCAAGG - Intronic
1074811519 10:117109969-117109991 CATTATTTCCACCTTCTAGATGG + Intronic
1075468255 10:122668368-122668390 CAATATGTGCATGTTCCTCAGGG + Intergenic
1076537714 10:131192670-131192692 CATTATGTCATTCCTTTTCATGG - Intronic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1077859964 11:6169330-6169352 CTTCATGTCCAGCTCCTTCAAGG - Exonic
1078401802 11:11034935-11034957 CATTATGTCCAGCTTCCCCATGG - Intergenic
1078428461 11:11269656-11269678 AATTGTGTCCATCTTCTTGGGGG + Intergenic
1081035768 11:38144007-38144029 CATTATTTTCTTCTTTTTCATGG + Intergenic
1081294504 11:41369265-41369287 CATTATGCCCAACTTGGTCATGG + Intronic
1081614372 11:44581857-44581879 CTCTGTGTCCACCTTCTTCATGG + Intronic
1081748774 11:45492467-45492489 CACTCTGTCTATTTTCTTCATGG - Intergenic
1082169771 11:48989287-48989309 AATTATGTTTTTCTTCTTCATGG + Intergenic
1082173453 11:49034208-49034230 AATTATGTTTTTCTTCTTCATGG - Exonic
1082857894 11:57825638-57825660 TATTATGTCCAACTACTTCAGGG + Intergenic
1082915088 11:58425268-58425290 CATTTTTTTCATCTTCTTTAGGG + Intergenic
1083499336 11:63088956-63088978 CATTCTGCCCATCATTTTCAGGG - Intronic
1084643731 11:70442033-70442055 TCTTGTGACCATCTTCTTCATGG - Intergenic
1086591409 11:88519192-88519214 CTTTCTATCCATCTTCTTCCAGG - Intronic
1086696063 11:89847361-89847383 AATTATGTTTTTCTTCTTCATGG - Intergenic
1086710093 11:89997128-89997150 AATTATGTTTTTCTTCTTCATGG + Intergenic
1086760220 11:90620765-90620787 CATTCTGGCCATCTCTTTCAGGG - Intergenic
1087605452 11:100371683-100371705 CCTTATGTCCTACTTCTCCAAGG - Intergenic
1087871039 11:103293518-103293540 CTTTCTTTACATCTTCTTCAAGG + Intronic
1089802670 11:121048464-121048486 CATTTTAACCTTCTTCTTCAGGG - Intronic
1090214535 11:124950041-124950063 CACTATGCTCATCATCTTCAAGG + Intergenic
1090303309 11:125667329-125667351 CATTATTTCATTCTTTTTCATGG + Intronic
1091606302 12:1954787-1954809 CATTGGGTCCATATTCTTCTGGG - Intronic
1092513683 12:9185468-9185490 CATTATGCTCATCTCTTTCAAGG - Intronic
1093590765 12:20899472-20899494 CTTCATGTACAACTTCTTCACGG - Intronic
1093809432 12:23473671-23473693 CATTATGTTTATATTTTTCATGG - Intergenic
1094694112 12:32799601-32799623 CATTATGTCTTTCTTTTTAATGG - Intronic
1096889626 12:54755883-54755905 TTTTGTGTCCATGTTCTTCAGGG + Intergenic
1096953701 12:55503625-55503647 CATTATGTATATCTCCTACAAGG + Intergenic
1097431861 12:59518883-59518905 CAGTATTTCCAGCTTCATCAGGG + Intergenic
1097931982 12:65197433-65197455 CATTCTGTCCATTGTGTTCATGG + Intronic
1100509129 12:95251824-95251846 CAGTATGTCCAAATTCTTTAAGG - Intronic
1101862798 12:108496689-108496711 CATTATGTCCATGTTACCCAAGG + Intergenic
1103805794 12:123571809-123571831 CATTTTGTCTGTGTTCTTCACGG + Intergenic
1105497720 13:20945350-20945372 AAGCATGTCCACCTTCTTCACGG + Intergenic
1105735555 13:23266360-23266382 CATTATATCACTCTTTTTCATGG - Intronic
1107449206 13:40493216-40493238 CATTATCACCATCTTGTGCAGGG + Intergenic
1108807830 13:54181591-54181613 CATGATGTCATTCTTTTTCATGG + Intergenic
1109704380 13:66071001-66071023 CAGTATGTCTCTTTTCTTCATGG - Intergenic
1109888037 13:68568090-68568112 CAATATGCCAATTTTCTTCATGG + Intergenic
1109968976 13:69739651-69739673 CAATATGTCAATCCTCTTCAAGG - Intronic
1111819959 13:93200685-93200707 CATTATTTCCTTCTTTTTAATGG - Intergenic
1112879211 13:104085185-104085207 CATTATTTCATTCTTTTTCATGG + Intergenic
1112979154 13:105359828-105359850 CATTTTGTCCATCTTATCCTGGG + Intergenic
1114452005 14:22833255-22833277 AAATATGTCCATCATCTTCAAGG - Intronic
1114528017 14:23378360-23378382 CATCATCTTCATCTGCTTCACGG + Exonic
1114815455 14:25952627-25952649 CATTAAGTTCACCTTCTTTATGG + Intergenic
1116150067 14:41129440-41129462 CACTATGTGCCTCATCTTCAAGG + Intergenic
1117241179 14:53835507-53835529 CATTATTTCCATTTTCTTGGGGG - Intergenic
1119094972 14:71821493-71821515 CATGATTTCCATCTATTTCATGG + Intergenic
1120595843 14:86434229-86434251 CATTATATGCAACTTCTGCAAGG + Intergenic
1122448540 14:101784780-101784802 CATTATGTAAATCATCTTGACGG + Intronic
1122893691 14:104744817-104744839 CAGGATGTCCAGCTTCGTCAGGG - Exonic
1123577943 15:21691566-21691588 CATTCTCCCCATCTCCTTCAGGG - Intergenic
1123614568 15:22134048-22134070 CATTCTCCCCATCTCCTTCAGGG - Intergenic
1125224857 15:37384375-37384397 CATTATTTTGACCTTCTTCAAGG + Intergenic
1126699177 15:51352498-51352520 CTTTATTTCCATTTCCTTCAGGG + Intronic
1126777886 15:52114772-52114794 AATTCTGTCCATCTGATTCAGGG - Intergenic
1126800338 15:52292331-52292353 TATTATCTTCCTCTTCTTCAAGG - Intronic
1127169100 15:56280382-56280404 CATAATGTACATATTTTTCAAGG - Intronic
1129500728 15:76035146-76035168 CTTTCTGTCCATCTACTCCAAGG + Intronic
1130424161 15:83778152-83778174 CATTATCCCCCTCTTTTTCAGGG - Intronic
1131304138 15:91226341-91226363 CACTCTGTGCATCTTCTTCTGGG - Exonic
1132157535 15:99506601-99506623 CATGATTTCCTTCTTTTTCATGG - Intergenic
1202986813 15_KI270727v1_random:425811-425833 CATTCTCCCCATCTCCTTCAGGG - Intergenic
1133895708 16:9926816-9926838 CACTAACTCCATCTTTTTCATGG + Intronic
1133920750 16:10150885-10150907 GATCATGTCCATCTTGTTTATGG + Intronic
1137971686 16:52991746-52991768 CATTATGTCATTCTTTTTTATGG - Intergenic
1140182548 16:72735156-72735178 CATTCTCTCCATCTCTTTCAGGG + Intergenic
1140682925 16:77402870-77402892 CTTTGTGTCCAGCTTCCTCATGG + Intronic
1140925340 16:79577211-79577233 CATTATATGCATTTTCTTCTGGG + Intergenic
1140986825 16:80165828-80165850 CATTATCTCCATCCTATTCATGG - Intergenic
1141073127 16:80976504-80976526 AATTCTGTCCATGTTCTCCAGGG + Intronic
1141377449 16:83545048-83545070 TATTCTGTTCATCTCCTTCAGGG + Intronic
1143601691 17:7950775-7950797 CATTATTTCATTCTTTTTCATGG - Intergenic
1143804585 17:9415807-9415829 CATCTTATCCAGCTTCTTCATGG + Intronic
1143945639 17:10589645-10589667 CATTATGTCAATCATGCTCAGGG - Intergenic
1146478909 17:33186671-33186693 CACTATGCCCCTCATCTTCAAGG - Intronic
1146705713 17:34999311-34999333 CATGATGTCAATCTTCCTCATGG + Exonic
1148387036 17:47241653-47241675 CATTATGTCCTTCCTTTTTATGG + Intergenic
1149366553 17:55951258-55951280 CATTAAGTCATTCTTCTTTATGG + Intergenic
1151036478 17:70805960-70805982 CCGTATGGCCATCTTGTTCATGG + Intergenic
1151374141 17:73672372-73672394 CATTATTTCCATCTATTTAATGG + Intergenic
1152315261 17:79576772-79576794 CATCATTTCCATGTTCTCCATGG - Intergenic
1153269304 18:3303879-3303901 CATTATTTCCTTCTTTTTTATGG - Intergenic
1153775438 18:8449322-8449344 CATTTTGTTTTTCTTCTTCATGG + Intergenic
1155620798 18:27776986-27777008 CCTTATACTCATCTTCTTCATGG + Intergenic
1156818132 18:41336841-41336863 CTTTAACTCCATCTTCTCCAAGG - Intergenic
1156918317 18:42487893-42487915 CATTCTTTCCATTTTCTACAGGG - Intergenic
1157456270 18:47831374-47831396 TATTCTGCCCATCTTCTTCCTGG + Exonic
1157564803 18:48672718-48672740 CTTTATGCCCCTCTTCTTCTGGG - Intronic
1157982326 18:52395794-52395816 CTTCATTTCCATCTTCTACATGG + Intronic
1159138789 18:64368206-64368228 CACTATCCCCATCTACTTCAAGG - Intergenic
1159392371 18:67809378-67809400 CATTATGCTCCTCGTCTTCAAGG + Intergenic
1159901034 18:74045740-74045762 TATTCTTTCCATCTTCTTTAGGG + Intergenic
1162207642 19:9067810-9067832 CAGTATTTCCTTCTTCTTTAAGG - Intergenic
1164789146 19:30961166-30961188 CATTATGTCGTTCTTTTTTATGG + Intergenic
1167384145 19:49154319-49154341 CATCATTGTCATCTTCTTCATGG + Exonic
1167384164 19:49154490-49154512 CATCATCGTCATCTTCTTCATGG + Exonic
1168436127 19:56318567-56318589 CATCATGTCCACCTTTTTTAAGG - Intronic
1168539217 19:57196585-57196607 CACTATGACCATTTTGTTCATGG + Intronic
926842916 2:17103398-17103420 TTTTATGTCATTCTTCTTCATGG - Intergenic
927001263 2:18796386-18796408 CATTATGGCTATTTTCTTAAAGG - Intergenic
927349514 2:22092465-22092487 TATTGTGTCAATGTTCTTCAGGG + Intergenic
928804890 2:35139206-35139228 CATTTTCCCCATCTTTTTCAGGG + Intergenic
929321761 2:40552141-40552163 TTTTATGTGCATCTACTTCAGGG + Intronic
929478294 2:42276314-42276336 CACTAGGTCCACATTCTTCATGG + Intronic
929982582 2:46695808-46695830 CATTATCCCCATTTTCTTCAAGG - Intergenic
930117874 2:47734405-47734427 CATAATTTCCACCTTCTTAAAGG + Intronic
930861138 2:56074189-56074211 GAATATATCCATCTTCTTCCTGG + Intergenic
931788052 2:65639382-65639404 CATTCTTTCCATTTTCTTCATGG + Intergenic
932211029 2:69930626-69930648 AAAGATGTCCATTTTCTTCAAGG + Intronic
933336238 2:80963308-80963330 CATTCTCCCCATCTCCTTCAGGG + Intergenic
933489291 2:82965123-82965145 CATTATATCATTCTTCTTTATGG - Intergenic
934764235 2:96871321-96871343 CATTATCTCCAGCATCTCCAAGG - Intergenic
934920256 2:98337995-98338017 TATTCTGTTCATTTTCTTCATGG + Intronic
935081744 2:99804749-99804771 CATTATTTCATTCTTTTTCATGG - Intronic
935499858 2:103825530-103825552 CATGATGTCATTCTTCTTTATGG + Intergenic
935582355 2:104767499-104767521 CATTAGGTCCAAGTTCCTCATGG - Intergenic
935894002 2:107714212-107714234 CATTATGTCAATTTTGTTAATGG - Intergenic
936229876 2:110691258-110691280 CCTTATGCCGATTTTCTTCATGG + Intergenic
936796455 2:116211426-116211448 AATTATTTTCTTCTTCTTCAGGG - Intergenic
936847878 2:116858619-116858641 CATGATCTCATTCTTCTTCATGG - Intergenic
936864963 2:117066856-117066878 TATTATGCCCACCTTCTTCATGG - Intergenic
936990153 2:118355368-118355390 CATCATGCCCAGCTTCTTCCAGG - Intergenic
938203582 2:129398240-129398262 CAATATCTCCAGCTTCATCAGGG - Intergenic
938870235 2:135467730-135467752 CATTCTGTCCCACCTCTTCACGG + Intronic
939109866 2:137993559-137993581 CATTCTCTCCATCTCCTTCTTGG - Intronic
939176180 2:138750189-138750211 CATCATTTCAATCTTCATCATGG - Intronic
939774827 2:146371540-146371562 CATTATCTCATTCTTTTTCATGG + Intergenic
940279879 2:151978235-151978257 TATTATCTCCATGGTCTTCATGG - Intronic
940563267 2:155329108-155329130 AATTATGTCATTCTTCTTTATGG - Intergenic
940909786 2:159200425-159200447 CCTGATGTCCATCGTCTTCATGG - Intronic
941227826 2:162870094-162870116 CTTTATTTACATCCTCTTCAGGG - Intergenic
943275307 2:185859381-185859403 CACAATGTCCTTCTTTTTCAAGG - Intergenic
944474435 2:200089251-200089273 CATTATGTGCATCCTCTCCTGGG + Intergenic
945994734 2:216426424-216426446 CATTATGTGCATTTTTTTCTGGG - Intronic
948175004 2:235936261-235936283 CACCATGTCCATCTTCCACATGG + Intronic
1169021991 20:2336969-2336991 CATTCTGTCCTTTTCCTTCAAGG + Intronic
1169155954 20:3329772-3329794 CATTATGTCCATATTGCTGAAGG + Intronic
1169656762 20:7932393-7932415 CTTTATTTCCATTCTCTTCATGG + Intronic
1170482581 20:16781667-16781689 CATGATGTCATTCTTTTTCATGG + Intergenic
1171062057 20:21974543-21974565 CATTATTTCAATCTTTTTTATGG + Intergenic
1173288129 20:41691204-41691226 CCTTATTTCCATATTCTTGAAGG - Intergenic
1174227564 20:49014604-49014626 AATTTTCTCCATCTTCTACATGG + Intronic
1175322470 20:58099032-58099054 CATCATGTGTATGTTCTTCAGGG - Intergenic
1175649970 20:60712155-60712177 AATTATGTCCTTATTCTTCTAGG + Intergenic
1177167902 21:17623738-17623760 CATTATGTCTTTTTTCTCCATGG + Intergenic
1177856093 21:26401924-26401946 CCTACTGTCCATTTTCTTCAAGG - Intergenic
1177903964 21:26952530-26952552 CAATAAGTGCAGCTTCTTCAGGG - Intronic
1178255136 21:31045235-31045257 TATTATATCCTTCTTCTTCCTGG - Intergenic
1181735848 22:24880887-24880909 CATTATTTCCATCTTATAGATGG - Intronic
1181786260 22:25229482-25229504 TATGATTTCCATCTTCTTCCCGG - Exonic
1181818430 22:25457305-25457327 TATGATTTCCATCTTCTTCCCGG - Intergenic
1182799410 22:33019181-33019203 AATCATTGCCATCTTCTTCAAGG + Intronic
1185170909 22:49293483-49293505 CACCATGGCCATCTTCTTGAGGG + Intergenic
1185393826 22:50576973-50576995 CAGCATGGCCATCTTCTCCACGG - Exonic
951631266 3:24723603-24723625 CAGAATGTCCTTCTTCTTAAAGG + Intergenic
952024397 3:29061436-29061458 CATTATTTCATTCTTTTTCATGG - Intergenic
954233542 3:49237776-49237798 CCTCATCTCCTTCTTCTTCAAGG - Intronic
955392452 3:58531366-58531388 CCTCATCTCCATCTCCTTCAAGG - Exonic
956224687 3:66944142-66944164 CATTATTTCAATCCTTTTCATGG - Intergenic
957370941 3:79293572-79293594 CATTGTGTCTGTTTTCTTCAAGG + Intronic
957408485 3:79804196-79804218 AAATATGTCCATCTTCTTTATGG - Intergenic
958435242 3:94088183-94088205 CATTAGGTTCATCTTCTTTGTGG + Intronic
958764728 3:98353047-98353069 CATAATGTGAATATTCTTCATGG - Intergenic
958770889 3:98424190-98424212 CATTAAGTCCATTTTTTCCAGGG - Intergenic
958870666 3:99555277-99555299 GTTTATGTCCATGTTCATCAAGG - Intergenic
960085537 3:113586704-113586726 CACAATGTCCATCTTCTCCTTGG - Intronic
960303731 3:116035709-116035731 CATTTAGTCCATCTGCTTCCTGG + Intronic
963007063 3:140736196-140736218 CATTATTTCCATTTTCCACAGGG - Intergenic
965425660 3:168519341-168519363 CATTATGTCCTGCTTTTTGAAGG - Intergenic
966245737 3:177805606-177805628 CATTCAGTCTTTCTTCTTCAAGG + Intergenic
966445806 3:179999381-179999403 CATTATGTCCACTTTGTTCATGG - Intronic
967622767 3:191652804-191652826 CAATAGTTGCATCTTCTTCAAGG - Intergenic
968961893 4:3749828-3749850 CAGAATGTCCTTCCTCTTCAAGG + Intergenic
969284421 4:6193958-6193980 CATTGCTTCCTTCTTCTTCATGG - Intronic
970911243 4:21278517-21278539 CATTATCTCCTTCTTTTTTATGG + Intronic
971451485 4:26805506-26805528 CATCCTTCCCATCTTCTTCAGGG + Intergenic
972436071 4:39036693-39036715 AATGATGTACATCTTTTTCAGGG - Intergenic
973148930 4:46864045-46864067 CTTTATTTCCATATTCTTGAAGG - Intronic
973786417 4:54336858-54336880 AATTATTTCCATATTCTGCAGGG + Intergenic
973855102 4:55003335-55003357 CATTGTGTCCATCCGCTTTAGGG - Intergenic
974362720 4:60902874-60902896 CATTATCTCCATCTTTTTTCTGG + Intergenic
974501355 4:62707686-62707708 CATGATTTCCCTCTTCTTAAAGG + Intergenic
975084679 4:70323791-70323813 CATTATCTTCATCATATTCAAGG - Intergenic
975202759 4:71610436-71610458 CATTATTTCATTCTTCTTCATGG - Intergenic
976048961 4:80987886-80987908 CATTATTTCATTCTTGTTCATGG + Intergenic
978260936 4:106757853-106757875 TATTATTGCCATTTTCTTCAAGG - Intergenic
979848170 4:125543424-125543446 CCTTATTTTCATCTTCATCATGG - Intergenic
981213391 4:142135478-142135500 CTTTAGGTCCATGTTCTCCATGG + Intronic
981581357 4:146251555-146251577 CTTTTTGTCAATCTTTTTCATGG + Intergenic
983639560 4:169932346-169932368 TATTATGTCTATCTTCCTCATGG - Intergenic
984428631 4:179620289-179620311 CATGATTTCATTCTTCTTCATGG - Intergenic
984550454 4:181153015-181153037 CATGATTTCCTTCTTTTTCATGG + Intergenic
986750862 5:10786910-10786932 CTTTATATCCATCATCTTAAGGG + Intergenic
987352038 5:17030852-17030874 CATTATCTCATTCTTCTTCATGG - Intergenic
987900978 5:24011903-24011925 CATTTTTTTCATCTCCTTCAAGG + Intronic
987914985 5:24201059-24201081 CATTCTTTCCATCTGTTTCAGGG - Intergenic
988052255 5:26045894-26045916 TTTTATGTCTATTTTCTTCAAGG - Intergenic
989097955 5:37798146-37798168 CACTATGGCCATTTTGTTCATGG - Intergenic
989237035 5:39159978-39160000 GATTTTGTTCCTCTTCTTCATGG + Intronic
989534047 5:42542958-42542980 CATTATTTCCTTCTTTTTTATGG + Intronic
990680997 5:58244324-58244346 CCATATGTCCATGTTTTTCAGGG - Intergenic
990840571 5:60075616-60075638 CATTCTCTCCATCTCTTTCAGGG + Intronic
991137584 5:63200232-63200254 CAAAATGTCCATTTTTTTCAAGG + Intergenic
991190801 5:63871010-63871032 CTCTGTGTGCATCTTCTTCATGG - Intergenic
993540529 5:89144951-89144973 CAGTATGTCCTTCTTTTTAAAGG + Intergenic
993796124 5:92269494-92269516 CATTCTCCCCATCTTTTTCAGGG - Intergenic
994244626 5:97466071-97466093 CTTTATGTCTTTCCTCTTCATGG - Intergenic
994363507 5:98883769-98883791 CATTATTTCATTCTTCTTTATGG - Intronic
994954048 5:106504443-106504465 TTTTATATCCATATTCTTCAAGG - Intergenic
995010113 5:107247979-107248001 GATTATAACCAGCTTCTTCAGGG + Intergenic
996663314 5:126028829-126028851 CATTCTCTCCATCTCCTTCAGGG - Intergenic
997594562 5:135097600-135097622 CATTATTTTCTTCTTTTTCATGG - Intronic
998238496 5:140421204-140421226 AATTCTGTCCATATTCTTCTTGG - Intronic
998271650 5:140711817-140711839 CATTATTTTATTCTTCTTCAGGG + Intergenic
1000303593 5:159976324-159976346 ATTTATGTCTTTCTTCTTCACGG - Intergenic
1001448860 5:171808633-171808655 CATGATTTCCTTCTTTTTCATGG - Intergenic
1002832692 6:837235-837257 CATTTTATGCATCTTTTTCAGGG + Intergenic
1003419614 6:5945072-5945094 CACTATGTTCCTCATCTTCAAGG + Intergenic
1006250839 6:32782427-32782449 CATTCTCTCCATCTCTTTCAGGG - Intergenic
1007811070 6:44485955-44485977 CTTTCTGTCCTTCCTCTTCAGGG - Intergenic
1008079716 6:47181036-47181058 CAGTGTCTCCATCTTCATCAGGG + Intergenic
1008119764 6:47598570-47598592 CATTTTTTCCATCTTTTTTACGG - Intronic
1008285952 6:49650655-49650677 GATCATGTCTATCTTCTTCCTGG - Intergenic
1009504214 6:64454322-64454344 CATATTGTTCTTCTTCTTCAGGG + Intronic
1009767747 6:68103338-68103360 CATTATGTCTATTTTCTTCTCGG - Intergenic
1010733579 6:79416427-79416449 GATTAAGTCCATATTTTTCAAGG + Intergenic
1011140282 6:84147154-84147176 CATTATTTCCCTCTTATTTAAGG - Intronic
1011188839 6:84709123-84709145 CATTACTTCAATGTTCTTCATGG + Intronic
1011723193 6:90180699-90180721 CATTATTTCATTCTTTTTCATGG + Intronic
1011857727 6:91715772-91715794 CACTTTGTCCTTCGTCTTCAAGG + Intergenic
1012688148 6:102277899-102277921 CATAATGTCATTCTTTTTCATGG + Intergenic
1012869239 6:104654543-104654565 CATTATGTTCATCTTCCTTAGGG - Intergenic
1013915342 6:115330608-115330630 CAGGTTGTCTATCTTCTTCAAGG - Intergenic
1014969897 6:127801530-127801552 CAGTGTCTCCAGCTTCTTCAGGG - Intronic
1015809156 6:137143870-137143892 CATAATTGTCATCTTCTTCATGG - Exonic
1016067520 6:139699368-139699390 ATTTATGTCCACCTGCTTCAGGG - Intergenic
1016080063 6:139845099-139845121 CAATGTGTCCATCATCTGCAGGG - Intergenic
1016474706 6:144414398-144414420 CATTTTGTCCTTATTCTACAAGG - Intronic
1017084050 6:150697249-150697271 CATTTTATCCACCTTCTTAAAGG - Intronic
1017157589 6:151336091-151336113 CATGATTTCCTTCTTTTTCATGG + Intronic
1017407470 6:154135670-154135692 CATGGTGTCCAACTTCTCCAAGG + Intronic
1019077774 6:169403741-169403763 CATGATCTCCTTCTTCTTTATGG + Intergenic
1019876730 7:3818842-3818864 CATTTTGTCCAACGTGTTCATGG - Intronic
1020479208 7:8637051-8637073 CATTTTGTCCTTTTTCTTCCTGG + Intronic
1021097416 7:16548962-16548984 AATTTTGTCTATTTTCTTCATGG + Intronic
1021325218 7:19258081-19258103 TTTTATGTCCATATTCATCAGGG - Intergenic
1021520776 7:21537103-21537125 CATTCTCTCCATCTCCTTCAGGG + Intergenic
1021886454 7:25144529-25144551 CCTTATGTCCATCTTCCCAAGGG - Intronic
1023020804 7:36010345-36010367 TCTTCTGTCCATCTGCTTCAGGG + Intergenic
1023775440 7:43601687-43601709 CATTATTTCCCTCTTCCTCTTGG + Intronic
1026204909 7:68248598-68248620 CCTATTGTCCAGCTTCTTCAAGG - Intergenic
1027505286 7:79009744-79009766 TATTATGTCCATTTCCTTCTGGG - Intronic
1028053983 7:86221164-86221186 CTTTCTCTCCATCTTCTTTAGGG - Intergenic
1028346295 7:89788091-89788113 CATGATGTCCTTCTTTTTTATGG + Intergenic
1030413979 7:109216547-109216569 AATTATATCCATCTTCTTTTAGG + Intergenic
1030418386 7:109274349-109274371 AATTTTATCCATTTTCTTCAAGG + Intergenic
1030807457 7:113935320-113935342 CATTCTCCCCATCTCCTTCAGGG + Intronic
1031075763 7:117210688-117210710 AATAATGTCCTACTTCTTCAAGG - Intronic
1033121700 7:138672117-138672139 CATGGTGTCCCTCTTCTTTAAGG - Exonic
1034750522 7:153564334-153564356 GATCATGTCCATTTCCTTCACGG - Intergenic
1034826872 7:154273342-154273364 CATTATTTCCATGATCTTTAGGG - Intronic
1036419091 8:8579341-8579363 CAAAATGTCCATCTTGTTCAAGG + Intergenic
1037466306 8:19163886-19163908 CATTTTGTTCATCTTCCTAAAGG + Intergenic
1037668547 8:20995008-20995030 TTTTATTTCCATCTTTTTCAGGG + Intergenic
1038372773 8:27010388-27010410 CATCATGTCCCTATTCTTCCTGG + Intergenic
1038883754 8:31640590-31640612 CAGCAGGTACATCTTCTTCATGG + Intronic
1039097916 8:33906844-33906866 CTTTATGTTTATCTTGTTCAAGG + Intergenic
1040087337 8:43358304-43358326 CATTATTTCATTCTTCTTTATGG + Intergenic
1040697340 8:50016512-50016534 CACTATGTTCATCACCTTCAAGG + Intronic
1041120215 8:54578955-54578977 CTTTATTTCCCTCATCTTCAGGG - Intergenic
1042309261 8:67364067-67364089 CAATAAGTCCATTTTCTTCTTGG + Intergenic
1042807123 8:72783174-72783196 CATTATTTCTAGCTTCTTCAAGG + Intronic
1043721667 8:83552411-83552433 CATTATTTCATTCTTTTTCATGG - Intergenic
1043819920 8:84850079-84850101 CATTTTGTACATTTTATTCATGG + Intronic
1043887937 8:85623955-85623977 CATTATGCTCAGCCTCTTCAAGG - Intergenic
1046235063 8:111413361-111413383 TTTTATGTCCATGTTCATCAGGG + Intergenic
1047200836 8:122765158-122765180 TATTATGTCCATATTCATAAGGG - Intergenic
1048109353 8:131450859-131450881 CATTATCTCATTCTTTTTCATGG + Intergenic
1050431069 9:5562305-5562327 CATTATCTCATTCTTTTTCATGG - Intronic
1050675837 9:8052206-8052228 CATTATCTCCATCTCTTTCAGGG + Intergenic
1052142342 9:25003039-25003061 CATTCTTCCCATCTCCTTCAGGG + Intergenic
1052804887 9:33004088-33004110 CATTATTTCATTCTTCTTTATGG - Intronic
1054821597 9:69526895-69526917 CATTATTTCACTCTTTTTCATGG - Intronic
1054966081 9:71027848-71027870 CATTCTCTCCATCTCTTTCAGGG - Intronic
1055871768 9:80889048-80889070 CAACCTGTCCATGTTCTTCAGGG - Intergenic
1056731648 9:89171009-89171031 CATTTTGTCCATCTTCCGGAGGG + Intronic
1056908920 9:90680133-90680155 CCTTTTTTCCATCATCTTCAGGG + Intergenic
1058476864 9:105343973-105343995 AAATATGTCCATATTTTTCATGG + Intronic
1059616003 9:115951358-115951380 CATTATGTCCTTTCTCTACAAGG - Intergenic
1060175112 9:121491954-121491976 AATTGTGTCTATCTTGTTCATGG + Intergenic
1062086610 9:134652457-134652479 CATGATGTCCACCTGTTTCAGGG - Intronic
1062116011 9:134809269-134809291 CCTTATCTCCGTCTTCTCCAGGG - Exonic
1186044586 X:5521323-5521345 CATAATTTCCTTCTTTTTCATGG - Intergenic
1187659894 X:21532444-21532466 AATTATCTCCATATTCCTCAGGG + Intronic
1188043411 X:25397356-25397378 CATTATATCCAGATTTTTCATGG - Intergenic
1188094906 X:26009375-26009397 GATTATACCCATCTTCTTCAAGG + Intergenic
1190506259 X:51129213-51129235 CATTCTCCCCATCTTTTTCAGGG + Intergenic
1190994611 X:55593976-55593998 CATAATGTCTCTCTTTTTCATGG + Intergenic
1191031991 X:55983949-55983971 CATTATTTCATTCTTCTTTATGG + Intergenic
1192026451 X:67457341-67457363 CAATATGTCCCTCTTCTGTAGGG - Intergenic
1192440257 X:71169126-71169148 CACCATTTCCATCTTTTTCAGGG - Intronic
1193016049 X:76735477-76735499 CTTTATGTCTGTCTTCTTCTTGG - Intergenic
1193053088 X:77122501-77122523 CAGTGTCTCCATCTTCATCACGG - Intergenic
1193225774 X:78981993-78982015 TATTTTGTCCATTTTTTTCATGG - Intergenic
1193703570 X:84792521-84792543 CATTCTCCCCATCTTTTTCAGGG - Intergenic
1193935428 X:87613359-87613381 AATTATGTCCAGTTTCTTAATGG + Intronic
1194379893 X:93178811-93178833 CTTTATGTCTTTTTTCTTCATGG + Intergenic
1194686233 X:96920701-96920723 CATTCTGTCCAGCTTCCTGAAGG - Intronic
1194692102 X:96999642-96999664 CATTTTGTACATTTACTTCATGG - Intronic
1195533166 X:105981123-105981145 CATTCTCTCCATCTCTTTCAGGG + Intergenic
1196473562 X:116057081-116057103 CATTCTCTCCATCTCTTTCAGGG + Intergenic
1196698588 X:118641137-118641159 CATTATGTGCATCTTCGTGTTGG + Intronic
1198137308 X:133766788-133766810 CATTATGTCCATCTTCTTCAAGG + Intronic
1198332968 X:135638890-135638912 CATTATTTATATTTTCTTCATGG + Intergenic
1199391947 X:147290565-147290587 GTTTATGTACATGTTCTTCAGGG - Intergenic
1199797423 X:151213916-151213938 CATTATGTTAATATTCTTGATGG - Intergenic
1200336786 X:155359536-155359558 CATTATCTCATTCTTTTTCACGG - Intergenic
1200349684 X:155481691-155481713 CATTATCTCATTCTTTTTCACGG + Intergenic
1200826268 Y:7646262-7646284 CATGCTGTCCTTCTTTTTCAAGG - Intergenic
1202191151 Y:22247232-22247254 CATTAAGTCACTCTTCTTAAGGG + Intergenic