ID: 1198137837

View in Genome Browser
Species Human (GRCh38)
Location X:133771795-133771817
Sequence CTCTGGGCAGAGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 837
Summary {0: 1, 1: 2, 2: 9, 3: 98, 4: 727}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198137833_1198137837 -7 Left 1198137833 X:133771779-133771801 CCTTAGGCTATAAATTCTCTGGG 0: 1
1: 0
2: 3
3: 13
4: 132
Right 1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG 0: 1
1: 2
2: 9
3: 98
4: 727
1198137830_1198137837 30 Left 1198137830 X:133771742-133771764 CCAAACTAGAGAAGTAAATTGTT 0: 1
1: 0
2: 2
3: 16
4: 249
Right 1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG 0: 1
1: 2
2: 9
3: 98
4: 727

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198137837 Original CRISPR CTCTGGGCAGAGAGGGAAGA AGG Intronic
900193167 1:1360013-1360035 CCATGGGGAGAGAGGGAACAGGG - Intronic
900482646 1:2906681-2906703 CTCAGGGGAGGGAGGGAGGAAGG + Intergenic
900740409 1:4327569-4327591 CTGTGGGCAGTGTGGGGAGAAGG - Intergenic
900917894 1:5651169-5651191 TTCTGGGCACACAGGGAAGGAGG + Intergenic
901078776 1:6571906-6571928 CTCTGAGCCAGGAGGGAAGAAGG - Intronic
901457119 1:9369414-9369436 CTCTGGGCTGGTAGGAAAGAAGG - Exonic
901617517 1:10553539-10553561 CTCTCTGAAGAAAGGGAAGATGG + Intronic
901894943 1:12303695-12303717 ATCTGGGAAGAGAGGAAGGATGG - Intronic
902545437 1:17186696-17186718 CTCCTTGCAGAGAGGGCAGAAGG + Intergenic
902777675 1:18685004-18685026 CTCTGGCAAAAGAGGGAGGAGGG + Intronic
903009236 1:20318631-20318653 CTCTTGGCCGAGCGGGCAGATGG - Exonic
903031187 1:20465468-20465490 CTCGGAGCAGAGGGAGAAGATGG - Intergenic
903129351 1:21268627-21268649 CTCTAGGCGGAGAGGGGAGAAGG - Intronic
903179171 1:21596945-21596967 CTCTGGACTCAGAGGGAACAAGG - Intronic
903790584 1:25890278-25890300 CACTGGGCAATCAGGGAAGAGGG - Intronic
903827856 1:26158352-26158374 GTGTGGGCAGAGAAGGAAGCGGG + Intergenic
903836123 1:26204236-26204258 TGTTGGCCAGAGAGGGAAGAAGG + Intergenic
904560672 1:31395172-31395194 CCCTGGACAGAGAGGGAATGAGG - Intergenic
904699258 1:32348606-32348628 GGCTGGGCTGGGAGGGAAGATGG - Intergenic
904793947 1:33044843-33044865 CTTAGGGAAGAGAGGGAAGAAGG + Intronic
905289379 1:36911113-36911135 CACTGGGGAGAGAGGGAGGGAGG + Intronic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
906191793 1:43903655-43903677 CCCTGGGAGGAGAGGGAGGAGGG + Intronic
907858956 1:58332281-58332303 GTCTGTGCAGAGAAGCAAGATGG - Intronic
908063131 1:60372995-60373017 CTCATGGCAGAAAGTGAAGAGGG - Intergenic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908505836 1:64799085-64799107 GTCTGGGAAGAGAAGGGAGAAGG - Intronic
908833514 1:68205523-68205545 CTCAGGGCAGTGCTGGAAGAAGG - Intronic
908871524 1:68618552-68618574 CTCTGGAATGAGAGGGTAGAAGG - Intergenic
909948682 1:81693126-81693148 CTCTTGGAGGAGAGGAAAGAAGG - Intronic
910855621 1:91692346-91692368 CTCTGGGGAGTGAGAAAAGAAGG + Intronic
911098250 1:94073329-94073351 CTCTGAGCAGAGGGGTATGATGG - Intronic
911150113 1:94590342-94590364 CCCTGGGGAGAGAGGGAGGGCGG - Intergenic
911262936 1:95708881-95708903 TTCTGGGCTGAGAGGTTAGAAGG + Intergenic
911347226 1:96711612-96711634 GTCTAGGCAAAGAGGGAAGCAGG + Intergenic
911476930 1:98385135-98385157 CTCTGGGGAGAAAGGAAAAAAGG - Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912947110 1:114094479-114094501 CTCTGGGCTGAGAGGGAAGGGGG + Intronic
913056236 1:115162788-115162810 CTCTGAGGAGGGAGGGAGGAGGG - Intergenic
913320219 1:117582721-117582743 CTGTGGGCAGTGGGGGAGGATGG + Intergenic
913367369 1:118055115-118055137 CTGTGGGCAGAAGGGGAAGATGG - Intronic
913498479 1:119449500-119449522 CTGAGGGCAAAGAAGGAAGAAGG - Intergenic
914225853 1:145719019-145719041 CTCCAGGCTGAAAGGGAAGAAGG - Intergenic
915040145 1:152961481-152961503 CTCTGAGGAGAGAGGAAAGAGGG + Intergenic
915465580 1:156095999-156096021 CCCTGGGCAGTGTGGGAAGGTGG - Intronic
915510705 1:156385532-156385554 CTCTGAGCAGAGAAGGAAGAGGG + Intergenic
915931234 1:160062152-160062174 CTCTGGGCAGGCTGGGGAGATGG - Intronic
915969433 1:160343378-160343400 CGCTCAGCAGAGAGGCAAGATGG + Exonic
916076469 1:161202631-161202653 CTCTGGCGAGGGAGGGGAGAGGG + Intronic
916647181 1:166797505-166797527 GTCTGGGCAGCGAGGGGAGCCGG + Intergenic
916816317 1:168356622-168356644 CTCAAGGAAGGGAGGGAAGAAGG - Intergenic
917134964 1:171781036-171781058 CTTTGCGGAGAGAAGGAAGAGGG + Intergenic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
918094357 1:181322277-181322299 ATCTGAGCAGTGGGGGAAGAGGG + Intergenic
918262240 1:182806518-182806540 CTTTGGGCTGAAAGGTAAGAGGG + Intronic
918514435 1:185346924-185346946 CTCTGGGCAGGGAGGGGAGGTGG - Intergenic
918742754 1:188156053-188156075 CATGGGGCAGTGAGGGAAGAAGG + Intergenic
919118968 1:193315306-193315328 GTCAGGGAAGAGAAGGAAGAAGG - Intergenic
919674864 1:200371279-200371301 CTCTGGGAAGTGAGGACAGAAGG + Intergenic
919930334 1:202217143-202217165 CCCTGGGCAGAGTGAGGAGATGG - Intronic
919982483 1:202650962-202650984 CACTGGGCAGAGTGGGAAGAAGG + Intronic
920292833 1:204936041-204936063 CTCTGGGGAGAGTGGGAGGGGGG + Intronic
920665869 1:207962850-207962872 TGCTGGGCAGAGAGTGAAGCTGG + Intergenic
920679587 1:208062416-208062438 AGCTGGGCAGTGAGGGAAGGAGG - Intronic
921815970 1:219563789-219563811 CTTTGAGAAGAGAGGGGAGAAGG + Intergenic
921936409 1:220800901-220800923 ATCCGGGCAGAGAGGGGAGTGGG - Intronic
922167869 1:223130687-223130709 CTCTGTTCAGATAAGGAAGAAGG - Intronic
922504816 1:226120438-226120460 CTCTGGACACAGAGGGATGGAGG - Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924064259 1:240207608-240207630 CTCCGGGTAGAGGGGGCAGAGGG - Exonic
924064298 1:240207707-240207729 CTCCGGGAAGAGGGGGAGGAAGG - Exonic
924064350 1:240207839-240207861 CTCCGGGAAGAGGGGGAGGAGGG - Exonic
924064404 1:240207971-240207993 CTCCGGGAAGAGGGGGAGGAGGG - Exonic
924064484 1:240208169-240208191 CTCCGGGTAGAGGGGGAGGAGGG - Exonic
924064498 1:240208202-240208224 CTCCGGGAAGAGGGGGAGGAGGG - Exonic
924319903 1:242838636-242838658 CTCTCAGCAGAGAGGGGAGTTGG - Intergenic
924467545 1:244312110-244312132 CTCTGGGCAGAAAGGGAGGCTGG + Intergenic
1062948176 10:1476366-1476388 AGCTGGGCTGAGTGGGAAGAAGG + Intronic
1063038614 10:2314760-2314782 CTCAGGGGATAGAGAGAAGAGGG + Intergenic
1063301312 10:4851358-4851380 CTCTGGGCAGAGAGGGCTAATGG + Intergenic
1063336628 10:5221931-5221953 CTATGGACAGAAAGGAAAGACGG + Intergenic
1063431989 10:5999247-5999269 TTCTGGGTAGAGTGGGCAGACGG + Intergenic
1063928417 10:11004028-11004050 CTCTGGGCAGGGGGAGACGAAGG - Intergenic
1064165304 10:12980522-12980544 CACAGGGCAGACAGGGAGGAGGG + Intronic
1064443739 10:15375271-15375293 CTAGGGGAAGAAAGGGAAGAAGG - Intergenic
1064717154 10:18188315-18188337 CTCTGGGAAGGAAGGCAAGAAGG - Intronic
1065581623 10:27177526-27177548 ATCTCGGCTGAGAGGCAAGATGG - Intronic
1066043693 10:31578508-31578530 CTTTGGCCAGAGTGGAAAGAAGG - Intergenic
1067143778 10:43678801-43678823 TGGTGGGCAGACAGGGAAGATGG - Intergenic
1068423960 10:56832105-56832127 CTTTTGGCAAAGTGGGAAGAGGG - Intergenic
1069142176 10:64840180-64840202 CTCTTAGCAGAGAGGGGAGCTGG - Intergenic
1069204625 10:65666489-65666511 CCCTGGGCTTAGAGGGAAGGTGG - Intergenic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069746805 10:70720260-70720282 AGCTTGGCAGAGAGGGAAGATGG + Intronic
1070550786 10:77489024-77489046 CTCTGCCTAGAGGGGGAAGATGG - Intronic
1070597784 10:77844858-77844880 CACTGGGCAGAGAGGGGGGCAGG + Intronic
1070785729 10:79161166-79161188 CTCGGGGCAGAGATGGCAGCAGG - Intronic
1070916960 10:80161174-80161196 GTGAGGGCAGAGAGGGGAGAGGG - Intronic
1070986925 10:80697137-80697159 TCCTGGGCAGAGAGGGAACCAGG - Intergenic
1071149770 10:82620392-82620414 CTCTCGGCAGAGAGGGGAGCTGG + Intronic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071776095 10:88789639-88789661 CACTAGGCAGACAGGGAAAATGG + Intergenic
1071791975 10:88964569-88964591 TTCTTGGTAGAGAGGGAAGGAGG + Intronic
1072436867 10:95422004-95422026 CCCTTGGCAGCGAGTGAAGAGGG + Exonic
1072553701 10:96498226-96498248 CGCTAGGCGGAGAGGGAAGGAGG + Intronic
1072578777 10:96722266-96722288 CTTTGGGGAGAGAAGGAAGAGGG - Intergenic
1072804887 10:98418010-98418032 CTGTGTGCAGCGAGGGAGGACGG - Intronic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1073189819 10:101643353-101643375 CCCTGGGAAGAGAGAGAACATGG + Intronic
1073639968 10:105241659-105241681 CTCTCAGCAGAGAGGGGAGCTGG + Intronic
1074866748 10:117548389-117548411 CTCTGGACAGCGAGGGCACAGGG + Exonic
1075072326 10:119327371-119327393 CCCAGGGCACAGAGGGGAGAAGG - Intronic
1075278693 10:121119701-121119723 TTGTGGGGTGAGAGGGAAGAAGG - Intergenic
1075585641 10:123656112-123656134 CTCATGGCAGAGAGGTTAGAGGG - Intergenic
1075623734 10:123946983-123947005 GTCTTGGGAGAGAGGGAAGAGGG + Intergenic
1075698644 10:124453971-124453993 CTCTATGCACAGAGGGAAGGTGG - Intergenic
1075719149 10:124574876-124574898 CCCTGGGGAGAGAGTGGAGAAGG - Intronic
1075808782 10:125209229-125209251 CTCAGGCCAGAGAGGGAGAAAGG + Intergenic
1076213500 10:128673365-128673387 CTCTGGGGATAGATGGAAAAAGG - Intergenic
1076286838 10:129307728-129307750 CTCTGGTGAGAGAGAGAAGGTGG + Intergenic
1076460989 10:130647364-130647386 CCCTGGGCAGCGAGGGCAGAGGG - Intergenic
1076685011 10:132194602-132194624 CTCTGAGCACAGAAGGGAGAGGG - Intronic
1076804711 10:132849662-132849684 CCCTGGGCTGAGAGTGAAGAAGG + Intronic
1076911984 10:133394897-133394919 CTGGGGGCCGAGGGGGAAGAAGG + Intronic
1076914971 10:133418859-133418881 CTCTGGGCAGAGAGGCCTGGAGG - Intronic
1077017926 11:405087-405109 CTCAGGGCCGAGAGGGGACAGGG + Intergenic
1077198490 11:1293401-1293423 GTGTGGGCAGAGAGGGGAGGAGG + Intronic
1078356963 11:10639649-10639671 ATCTGGGCAGGGAGGCAAGCAGG - Intronic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1078925292 11:15869417-15869439 CTATAGGCAGACAGGGCAGAAGG + Intergenic
1079617213 11:22510511-22510533 TGCTGAGCGGAGAGGGAAGAGGG - Intergenic
1080041522 11:27764205-27764227 CTCTGGACATGGAGGGAATAAGG - Intergenic
1080042209 11:27770789-27770811 CTCTGGACAGCCAGGGAGGAAGG - Intergenic
1080609507 11:33891932-33891954 GTCCTGGCAGAGAGGGGAGATGG - Exonic
1081587642 11:44398324-44398346 CCCCCGGCACAGAGGGAAGAGGG - Intergenic
1081666370 11:44919191-44919213 CTGGGGGCAGAGGGAGAAGATGG - Intronic
1081734626 11:45394308-45394330 TTGTGGGCACAGAGGGTAGAGGG + Intergenic
1082803268 11:57429898-57429920 TTATGGACAGAGTGGGAAGATGG + Intergenic
1083332865 11:61907101-61907123 GGCTGGGAGGAGAGGGAAGAAGG + Intronic
1083418889 11:62542650-62542672 TCCTGGCCAGGGAGGGAAGAGGG - Intronic
1083430961 11:62613263-62613285 CCTTGGGCAGAGATGGGAGATGG + Exonic
1083994854 11:66266850-66266872 CTGTGGGCAGAGGGGGCAGGTGG - Intronic
1084091678 11:66882916-66882938 TTCTGGGCAGGGGGGGCAGAAGG + Intronic
1084153172 11:67300668-67300690 CTCTGGGCTGAGGAGGAAAACGG + Intronic
1084859518 11:72009186-72009208 CTGTGGGCAGAGAGGGTGGGTGG + Intronic
1084902081 11:72317221-72317243 CTGTGGGGAGAGAGGGCAAATGG + Intronic
1084970344 11:72768126-72768148 CTGTGGGCTGTGAGGGTAGAGGG - Intronic
1085361639 11:75893303-75893325 TTCTGGGCAGAGTGGCCAGAAGG - Intronic
1085482905 11:76837595-76837617 CTCGGGGGAGATGGGGAAGAGGG - Intergenic
1085512060 11:77093448-77093470 CTCTGGCCAGGAAGGGGAGAGGG + Intronic
1085709295 11:78814394-78814416 CTCTGGGGAGAGAAAGGAGAAGG + Exonic
1086748334 11:90457719-90457741 GACTGGGGAGAGAGGGAAGTGGG + Intergenic
1088409091 11:109513678-109513700 CTCTGGGGAGACAGTGTAGATGG + Intergenic
1089740232 11:120577351-120577373 CTATGGGAAGAGTGGGATGATGG + Intronic
1090056301 11:123428022-123428044 CTATGGGCAGCTTGGGAAGAGGG - Intergenic
1091097491 11:132837860-132837882 CCCTGAGCAGTGAGGGAGGAGGG - Intronic
1091519609 12:1224116-1224138 CTCTGGGAAGAGATATAAGAGGG - Intronic
1092346044 12:7715367-7715389 GTCTGTGCAGAGAGAAAAGATGG + Exonic
1092416357 12:8293184-8293206 ATCAGGGCACAGAGGTAAGAGGG + Intergenic
1092802899 12:12188357-12188379 AGATGGGCAGAGAGGGAGGAAGG + Intronic
1092947882 12:13473707-13473729 CTCTGGGGAGAGGAGGAAGATGG + Intergenic
1093930641 12:24951999-24952021 CTTTCAGCAGAGAGGGAAGCGGG + Intergenic
1095982824 12:47982608-47982630 CCCTGGGGAGGGAGGTAAGAGGG + Exonic
1096521887 12:52189146-52189168 CTCTGGGTAAAGAGAGGAGAGGG - Intronic
1096861684 12:54533296-54533318 GTAGGGGCAGAGAGGGAGGATGG + Intronic
1096995356 12:55834819-55834841 CACAGGGCAGAGAGGGAGTAAGG - Intergenic
1097746601 12:63310482-63310504 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
1097765504 12:63522031-63522053 CTCTAGGCAGAAAGAGAAGAGGG + Intergenic
1100262178 12:92942606-92942628 CCCTGGGCATAGATGCAAGATGG + Intergenic
1100272080 12:93035534-93035556 GTCTGTGCAGAGAGAGAGGATGG + Intergenic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1101741125 12:107500816-107500838 ATCTGGGCACAGAGTGAACAAGG - Intronic
1101837258 12:108304232-108304254 CTCTAGGCTGAGGGGCAAGAGGG - Intronic
1102273456 12:111560602-111560624 CACTGTACAGGGAGGGAAGAAGG + Intronic
1102409452 12:112704599-112704621 CTCTGGGAAGAAAGAGATGATGG - Intronic
1102485531 12:113252805-113252827 CCCTAGGCAGAGACAGAAGAAGG - Intronic
1102599733 12:114020707-114020729 CTCTGGGAACAGAGACAAGAAGG + Intergenic
1102706069 12:114881616-114881638 CTCTGGGGTGAAAGGGAGGAAGG - Intergenic
1102712146 12:114937813-114937835 CTATAGGCAGAGTAGGAAGATGG - Intergenic
1103024550 12:117562996-117563018 CTCTGGAGACAGAGGGAAGAGGG + Intronic
1103054078 12:117804940-117804962 CTCTGGGCAGCAGGGAAAGATGG - Intronic
1103322844 12:120101870-120101892 GGCTGGGCAGAGCGGGAAGAAGG - Intronic
1103723054 12:122984835-122984857 TGCTGGGGAGAGAGGGCAGACGG + Exonic
1104088444 12:125494930-125494952 TTCAGGGAAGAGGGGGAAGAGGG - Intronic
1104158199 12:126153452-126153474 ATCTGGGAAGAGAAGGAAAATGG + Intergenic
1106076282 13:26464065-26464087 CTCTGGCCAGGGCTGGAAGAGGG + Intergenic
1106635980 13:31528837-31528859 GAATGGGGAGAGAGGGAAGAGGG - Intergenic
1107037053 13:35912602-35912624 CTCTCAGCAGAGAGGGGAGCTGG - Intronic
1107131852 13:36905020-36905042 CACTGAGCACTGAGGGAAGACGG + Intronic
1107151884 13:37121189-37121211 TTCTGAGCAGAGAGGGAAAGAGG - Intergenic
1108264580 13:48693648-48693670 CTCTGAAAAGAGAGGGAGGAAGG + Intronic
1108550874 13:51542576-51542598 CTCTGGGCAGTGGAGGCAGATGG - Intergenic
1109136414 13:58656783-58656805 CTCTCAGCAGAGAGGGAAGCTGG + Intergenic
1109242936 13:59913386-59913408 CTGTGGGCTGTGAGGGAAGCTGG - Intronic
1109883034 13:68506975-68506997 CTCTCGGCAGAGAGGGTAGCTGG - Intergenic
1110508133 13:76314392-76314414 ATATGGGCAGAGAGGGAAAAGGG + Intergenic
1111047183 13:82829280-82829302 CTCTCAGCAGAGTGGGAAGCTGG + Intergenic
1111213313 13:85108969-85108991 CTCTCAGCAGAGAGGGGATATGG + Intergenic
1111726250 13:92013276-92013298 CTCTCAGCAGAGAGGGGAGCTGG + Intronic
1112937444 13:104818973-104818995 TTCTTGGGAGAGAAGGAAGATGG - Intergenic
1112949742 13:104977981-104978003 GACTGGGAAGAGAGGGAAAAAGG - Intergenic
1113108040 13:106792173-106792195 CTCAGGACAGAGAATGAAGATGG - Intergenic
1113504514 13:110806013-110806035 TTGTGGGCAGAGAGGGAAAGTGG + Intergenic
1113606278 13:111609846-111609868 CACTGGGCACAGAGGGCAGCAGG - Intronic
1113698327 13:112364588-112364610 ATCTGGGAAGGGAGGGAACAGGG + Intergenic
1113698791 13:112367126-112367148 ATGAGGGCAGAGAGGGAAGCTGG + Intergenic
1114369258 14:22067803-22067825 CTCCGTGCTGAGAGGAAAGATGG + Intergenic
1114376645 14:22153518-22153540 CTATGGACATAGAGGGTAGAAGG + Intergenic
1115569840 14:34656048-34656070 CTGTGGCCAGAGAGTGAGGATGG + Intergenic
1115739353 14:36371680-36371702 GTCTGTGCAGAGAGAAAAGATGG + Intergenic
1116355586 14:43924727-43924749 CTCTCGGCAGTGAGGGAATGCGG - Intergenic
1116907751 14:50421755-50421777 CTCTGAGCAGAGTAGGTAGAAGG + Intronic
1116982943 14:51190537-51190559 ATCTGGGCAGGGAGGAATGAGGG - Intergenic
1117066248 14:52015274-52015296 CTCTGAGCAGATGGGGAAGAGGG + Exonic
1117928575 14:60812818-60812840 CTCTTAGCAGAGAGGGGAGCTGG - Intronic
1118360587 14:65053363-65053385 CTCTGGGGAGGGAAGGGAGAGGG + Intronic
1118625620 14:67656389-67656411 GTCTGGGCAGACAGGGAAAGGGG - Intronic
1118637352 14:67759864-67759886 CTTTGGGCAGAGTGGGCAAAGGG + Intronic
1119202380 14:72765976-72765998 CTCTGGGGAGGGAGTAAAGAAGG + Intronic
1120077319 14:80173296-80173318 CTCTTGGCAGGGAAGGAAGCAGG + Intergenic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120900665 14:89572941-89572963 CTCCTGGCAGAGAGGGAGGCAGG + Intronic
1121249803 14:92490905-92490927 CCAAGGGCAGAGAGGCAAGAGGG - Intronic
1121302291 14:92881334-92881356 CTCTGTGCAAAGAGGGAGGTGGG - Intergenic
1121330162 14:93044711-93044733 AACACGGCAGAGAGGGAAGAAGG + Intronic
1121565116 14:94903596-94903618 CACTGGGCAGTGCAGGAAGAGGG + Intergenic
1121600383 14:95198993-95199015 CTGGGGGAAGAGGGGGAAGATGG + Intronic
1121714430 14:96062980-96063002 CTCTGGGCAGAGAGGGTCTGTGG - Intronic
1121722369 14:96118607-96118629 AGCTGGGAAGACAGGGAAGAAGG - Intergenic
1121817500 14:96939874-96939896 CTCGGGCCAGAGAGAGAAGAAGG - Intergenic
1121878643 14:97478945-97478967 CCCAGGGCAGAAAGGGCAGAAGG + Intergenic
1122007432 14:98717004-98717026 CACTTGGCAGAGAGGGAGGCGGG + Intronic
1122123708 14:99568086-99568108 CTTTAGGCAGAGAGGCAGGAGGG + Intronic
1122177966 14:99934983-99935005 CCCTGGGAAGAGAGGCAGGAAGG + Intronic
1123173958 14:106400307-106400329 ACCTGGGCAGGAAGGGAAGAGGG - Intergenic
1123182167 14:106481241-106481263 ACCTGGGCAGGAAGGGAAGAGGG - Intergenic
1202944736 14_KI270726v1_random:15489-15511 ACCTGGGCAGGAAGGGAAGAGGG + Intergenic
1123467330 15:20526774-20526796 AACTGGGCTGAGAGGGAAGGGGG + Intergenic
1123650784 15:22474268-22474290 AACTGGGCTGAGAGGGAAGGGGG - Intergenic
1123741192 15:23283110-23283132 AACTGGGCTGAGAGGGAAGGGGG - Intergenic
1123745805 15:23319448-23319470 AACTGGGCTGAGAGGGAAGGGGG + Intergenic
1124035999 15:26054107-26054129 TGCTGGGCATAGAGGGAGGATGG + Intergenic
1124278077 15:28342765-28342787 AACTGGGCTGAGAGGGAAGGGGG + Intergenic
1124304626 15:28568843-28568865 AACTGGGCTGAGAGGGAAGGGGG - Intergenic
1124653981 15:31493970-31493992 CTCAAAGCAGAGAGGGAGGAGGG + Intronic
1124955781 15:34359505-34359527 CACTGGGCTGGGAGGGAACAAGG - Intronic
1125200072 15:37095431-37095453 CTCTAGGGAGAGAGGGAGGAAGG - Intronic
1125447898 15:39777260-39777282 ATCAGAGCTGAGAGGGAAGAAGG - Intronic
1125677258 15:41509081-41509103 CTCTGGGCTGATGGGGAAGATGG - Exonic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127611821 15:60644691-60644713 CTTTGGGAAGAGAGAGAAGGAGG - Intronic
1128218108 15:65948131-65948153 CCCTGGGCAGGGAGGGATGGTGG - Intronic
1128480289 15:68031551-68031573 CTGGAGGCAGAGAGGGAAGTTGG - Intergenic
1128947925 15:71842985-71843007 CTCAGAGCAGAGAGGGGAAAAGG - Intronic
1129055118 15:72813849-72813871 CTCTGGGGAGCTAGGGAAGGAGG - Intergenic
1129826915 15:78640532-78640554 CACTGGGCCGAGAAGGAAGGGGG - Intronic
1131223987 15:90608537-90608559 CTCTGAGCTGAGAGGAAGGAAGG - Intronic
1131227604 15:90638466-90638488 CTGTGGGCAGAAAGGAAAGTTGG - Exonic
1131253140 15:90844080-90844102 CTCTGGGCTGAATGGGAAGGAGG - Intergenic
1131379903 15:91954917-91954939 CTCAGGGCACAGAGCCAAGAAGG - Intronic
1131687992 15:94792042-94792064 AGCTGGGCAGAGAGGGAAGTTGG + Intergenic
1131699564 15:94919456-94919478 ATCAGGCAAGAGAGGGAAGATGG - Intergenic
1132121710 15:99181681-99181703 TGCTGGGCAGAGATGGGAGAGGG - Intronic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132294136 15:100722973-100722995 CCCTGGGTAGAGGGAGAAGAGGG - Intergenic
1132482817 16:175083-175105 CTGTGGGCAGAGTCAGAAGAGGG + Intergenic
1132919299 16:2376631-2376653 CTCTCTGGAGAGAGGGATGAGGG - Intergenic
1132943081 16:2518116-2518138 CTGTGGGCAGAGAGGGGGCAGGG + Intronic
1133036229 16:3035818-3035840 TTCTGGGAAGAGAGGGGACAGGG - Intronic
1133119836 16:3599223-3599245 CTCGGGGCTGAGATGGCAGAGGG - Intronic
1133221839 16:4322200-4322222 CTCTGGGCTGAGAGAGCAGGTGG + Intronic
1134231131 16:12431229-12431251 GTCTGGGCAAAGGGGGAAGAGGG + Intronic
1135181842 16:20281592-20281614 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1135222777 16:20627247-20627269 CACTGGGGACAGAGGTAAGATGG - Exonic
1135926821 16:26702080-26702102 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1135943086 16:26839856-26839878 CTCTGGGAAGTTAGGGCAGAGGG + Intergenic
1136143608 16:28302452-28302474 CTCTGGGCAGGGTGTGAAGGGGG + Intronic
1136500061 16:30665541-30665563 CACTGGGCAGGGAGGGATCATGG - Intronic
1137004883 16:35266640-35266662 CTCTGAGAAGAGAGGGACGTAGG - Intergenic
1137488290 16:48909665-48909687 TTCTGGAAAGAGAGGGAAGGAGG + Intergenic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1138077075 16:54053154-54053176 ATCTCTGCAGAGAGGAAAGATGG - Intronic
1138152331 16:54670235-54670257 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
1138416428 16:56874152-56874174 CTCTGAGCTGGGAGGGAATAGGG - Intronic
1138526968 16:57614464-57614486 CTCTAGGCAGAGATGGCAGTAGG + Intronic
1138756516 16:59492962-59492984 CTCGGGGCAGAGAGTGGGGAAGG + Intergenic
1139347788 16:66315481-66315503 CTCTGGCCAGAGAAGGAGAAAGG + Intergenic
1139477922 16:67212133-67212155 CTCTGGGGAGAGGGAGAAGAGGG + Intronic
1139592240 16:67939776-67939798 CTGTGTGCAGTGAGGCAAGATGG - Exonic
1139875056 16:70139306-70139328 CTCAAGGCAGACCGGGAAGAAGG - Intronic
1140055965 16:71526097-71526119 CTATGGGCAGAGTGGGGAGGTGG - Intronic
1140360727 16:74341825-74341847 CTCAAGGCAGACCGGGAAGAAGG + Intergenic
1140985684 16:80156287-80156309 CACTGGGCAAAGAAGGAAGAAGG + Intergenic
1141073204 16:80977426-80977448 CCCTGGGCAGAAGGGGAAAAGGG + Intronic
1141292062 16:82727455-82727477 TCCTGGGTAGAGAGGGAATAAGG - Intronic
1141455280 16:84137224-84137246 TTCTGGGCAGAGAGGAGGGAAGG + Intronic
1141581938 16:85005225-85005247 CTCTAGGAAGACAGGGAAGGAGG - Intronic
1141769101 16:86078124-86078146 CTCTGGGAAGGGAAGGCAGAGGG - Intergenic
1141927182 16:87177532-87177554 CTCTGGGCAGAGAGAGGACGAGG + Intronic
1141929117 16:87189350-87189372 GTCTGGGGAGAGCGGGAAGTGGG + Intronic
1142753976 17:2004670-2004692 CCCTGGGCAGAGAGGGCAGAGGG + Intronic
1142918704 17:3165111-3165133 TTCTGGGGAGAGAGAGGAGATGG + Intergenic
1142968582 17:3596273-3596295 CTTTGGGCAGAGAGAGGAGCAGG - Intronic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1143327104 17:6106593-6106615 CTCTGGGGAGGGAAGGAGGATGG + Intronic
1143364380 17:6396310-6396332 GACTGGGCAGAGAAGGAAGAAGG + Intronic
1143495670 17:7311327-7311349 CTGGGGGCAGATAGGGAAGGAGG - Intronic
1143714767 17:8758859-8758881 GTCTGGTGAGAGAGGGAGGAAGG + Intergenic
1143792514 17:9308768-9308790 CCTTGGGCAGAAAGGGAAGCAGG + Intronic
1144670935 17:17132220-17132242 CACTGGCCAGGGAGGGAAGGAGG - Intronic
1144792116 17:17866307-17866329 AGCTGGGAGGAGAGGGAAGATGG + Exonic
1145985469 17:29043070-29043092 GGCTTGGCAGAGAGGGAAGCGGG + Exonic
1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG + Exonic
1147155401 17:38542207-38542229 CTCTGGGGAGGGAGGGACTAGGG + Intronic
1147186928 17:38717972-38717994 CTTTGGGAAGAAAGGGGAGAGGG - Intronic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147362931 17:39942964-39942986 CCTTGGGGAGTGAGGGAAGATGG + Intronic
1148465575 17:47863123-47863145 CTCTGGGCAGGAAAGGAGGATGG + Intergenic
1148739779 17:49886228-49886250 CTCTGCCCAGAGAGGGGAAAAGG + Intergenic
1148781396 17:50123996-50124018 ACCAGGGGAGAGAGGGAAGAAGG + Intronic
1148862660 17:50612726-50612748 TTCGGGGCAGGGAGGGAGGAAGG - Intronic
1149028381 17:52056274-52056296 TTCTGTTCAGTGAGGGAAGAAGG + Intronic
1149123279 17:53196272-53196294 CTCTGGGAAGAGAGGCAGGATGG + Intergenic
1149350559 17:55782706-55782728 CTCTGGGCAGAGAGGACAACTGG - Intronic
1149535702 17:57431817-57431839 CTGGGGGCAGAGAGTGAAGTGGG - Intronic
1149881048 17:60290788-60290810 CTCTAGGGAGGGAGGGGAGAGGG + Intronic
1149965228 17:61155875-61155897 ATCTGAGTGGAGAGGGAAGAAGG - Intronic
1150059989 17:62059363-62059385 TTCTTGGTAGTGAGGGAAGAGGG - Intronic
1150292685 17:63990685-63990707 CTCTGGGCTGCCAGGAAAGATGG - Intergenic
1151155946 17:72123104-72123126 CTCTGGGTAGAGAGGGGAGCGGG - Intronic
1151407645 17:73899825-73899847 TACTGGCCAGAGAGGGGAGAGGG - Intergenic
1151555164 17:74842993-74843015 CTCCGGGAAGAGCGGGAGGAAGG + Exonic
1151680146 17:75618893-75618915 CTCTGGGCAGTGAGTGAAAAGGG + Intergenic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152189008 17:78876857-78876879 CTCCAGGCAGAGAGGGGAGATGG - Intronic
1152271002 17:79324834-79324856 CTCTGGGCAGGCAGAGAAGCAGG + Intronic
1152524456 17:80879510-80879532 TCCAGGGCAGTGAGGGAAGAAGG - Intronic
1153002119 18:465056-465078 TTCTGGGAAGAAAGGGGAGATGG + Intronic
1153200644 18:2644206-2644228 CTCTGGCAAGAGTGGAAAGAAGG - Intergenic
1153749789 18:8217361-8217383 AGCTGGGCACAGGGGGAAGAAGG - Intronic
1153981652 18:10315503-10315525 CTCAGAGCAGAGATGGATGAAGG - Intergenic
1155108364 18:22689254-22689276 CTGGAGGCAGAGAGGGAAGCTGG + Intergenic
1155637786 18:27975849-27975871 CTCTCAGCAGAGAGGGGAGCTGG + Intronic
1156125799 18:33903886-33903908 CCCTGGGCATAGAGGGAGGGTGG - Intronic
1156285878 18:35695436-35695458 TTATGGGCTGAGAGTGAAGAAGG + Intronic
1156547368 18:37978141-37978163 CTCATGGCAGAAAGGGAAGTTGG + Intergenic
1156625303 18:38901070-38901092 GTGTGGGGAGAGAGAGAAGAAGG + Intergenic
1156905604 18:42348661-42348683 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG + Intergenic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1158282499 18:55842802-55842824 CACTAAGCAGAGAAGGAAGAAGG - Intergenic
1158311701 18:56166426-56166448 CTATAGGAAGAGAGGGAAGGGGG + Intergenic
1158933239 18:62341499-62341521 CTGAGGGGAGAGAGGGAAAAGGG - Intronic
1159521623 18:69532216-69532238 CTCTGTTCAGATAGGCAAGAGGG - Intronic
1159548570 18:69871195-69871217 CTGGGGGCAGAGATGGCAGAGGG - Intronic
1159941996 18:74415309-74415331 CTATGGGCAGAGGGGGCAGCTGG + Intergenic
1159978213 18:74742142-74742164 GTTTTGGCAGAGAAGGAAGATGG + Intronic
1160671781 19:368468-368490 CTCTGGGGAGGGAGGGAGGGAGG + Intronic
1161204436 19:3033721-3033743 CTGTGCTTAGAGAGGGAAGAGGG - Intronic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161426918 19:4208743-4208765 GGCTGGGGAGAGAGGGAAGCAGG - Exonic
1161503820 19:4633221-4633243 CTAGGGGTAGAGAGGGAGGAGGG + Intergenic
1161534739 19:4812007-4812029 CGACGGGCAGAGAGGGAGGAGGG - Intergenic
1161697468 19:5777493-5777515 CTCTGGCTAGAGAGGGCGGAAGG - Intronic
1161821587 19:6533667-6533689 CTCTGGAGGGAGAGGGAAGGGGG - Intronic
1161913940 19:7214944-7214966 AGCTGGGAAGACAGGGAAGAAGG - Intronic
1162798255 19:13097710-13097732 CTCGGGGCGGAGAGGGAGGGAGG - Intronic
1162820013 19:13217180-13217202 TTCTGGGCAGAGAGAACAGAGGG + Intronic
1162847765 19:13406669-13406691 CACTGGGCAGAGAGGGTGGGTGG + Intronic
1162969140 19:14169734-14169756 CTCCGGGAAGAGTGGGGAGAAGG - Intronic
1163051310 19:14686200-14686222 CTCTTGGGAGAGAGGGAGTAAGG - Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163814909 19:19458880-19458902 CTCTGGAGAGAGGGGGAAGCTGG - Intronic
1163895263 19:20052746-20052768 CTCTGGCTAGAGAAGGCAGAGGG - Intergenic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1164813686 19:31177842-31177864 CACTGCGCAGAGAGGGGAGGCGG + Intergenic
1164828650 19:31303233-31303255 CTCTGGGAAGAGACTGAAGATGG + Intronic
1165283769 19:34820148-34820170 CACTTTGCAGAGTGGGAAGAAGG + Intergenic
1165486764 19:36101180-36101202 GTGGGGGCAGAGAGGGAACAAGG - Intronic
1165797134 19:38525930-38525952 GTCTTGGCAGGGAGGGAAGGAGG - Intronic
1165924454 19:39318628-39318650 CTCTTGGGTCAGAGGGAAGAGGG - Intergenic
1166377231 19:42334342-42334364 CTCTGGAAGGAGAGGGAAGTGGG - Intronic
1166875357 19:45893633-45893655 CTGGGGGAAGACAGGGAAGATGG + Intronic
1167120383 19:47513152-47513174 CTCTGGGCAGAGGAAGGAGAAGG - Intronic
1167340479 19:48912964-48912986 GGCTGGGCAGAGGGGGCAGAGGG + Intronic
1167477869 19:49711475-49711497 ATCTGGGCAGAGAGGGTACAGGG - Intronic
1168132954 19:54332479-54332501 CTCTGGGCTCAGAGGGAGGGTGG - Intergenic
1168419470 19:56191806-56191828 GTCTGGGCAGAGGTGGGAGAAGG - Intronic
1168421530 19:56207284-56207306 GTCTGGGCAGAGGTGGGAGAAGG + Intronic
1168423912 19:56223587-56223609 GTCTGGGCAGAGGTGGGAGAAGG - Intronic
1168426790 19:56245447-56245469 GTCTGGGCAGAGGTGGGAGAAGG + Intronic
1168433849 19:56302488-56302510 AGAAGGGCAGAGAGGGAAGAAGG - Intronic
1168636407 19:58000537-58000559 CTCTGTGCAGAGCTGGAACAAGG - Intronic
1168705628 19:58468769-58468791 GTCTGGTCAGGGAGGGCAGAGGG + Intronic
925140108 2:1544264-1544286 CTCTGGGCAGTGAAGGGAGGTGG + Intergenic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925878261 2:8329966-8329988 TTCTGGGCACAGAAGGAAGATGG + Intergenic
926402728 2:12515059-12515081 ATCTGGGCAGACAGCGAACAGGG + Intergenic
927202273 2:20585143-20585165 CTCTGGACAGAGTGGGAGGAGGG - Intronic
927208438 2:20624419-20624441 CTCTGTGCAGAGTTGGCAGAGGG - Intronic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927721744 2:25387569-25387591 CCCTAGGTAGAGAGGGCAGAGGG - Intronic
927966533 2:27273438-27273460 CACTGGGTAGAGAGAGCAGAAGG - Intronic
927966573 2:27273804-27273826 CACTGGGTAGAGAGAGCAGAAGG - Intronic
927968561 2:27288306-27288328 CTCTGGATAGCCAGGGAAGAGGG + Intronic
928606461 2:32947964-32947986 CTCTGGGCGCCGCGGGAAGAGGG + Intronic
929044062 2:37773550-37773572 CTCTGGGCAGGGAGGGGCCAAGG - Intergenic
929133702 2:38602890-38602912 CTCCGGGCAGGGAGCGGAGACGG - Exonic
929335495 2:40739232-40739254 CCCTGGGCAGTGAGAAAAGATGG + Intergenic
929473904 2:42225703-42225725 CTATCTGCAGGGAGGGAAGAAGG - Intronic
929552991 2:42906091-42906113 CTCTAGGCAGAGGGGAAAGAAGG + Intergenic
929779570 2:44949191-44949213 CTAGGGGCAGGGACGGAAGAGGG - Intergenic
929954084 2:46442312-46442334 CTATGGGGAGAAAGGGAAGAGGG - Intronic
930065521 2:47324653-47324675 CCCTGGGCAGTGAGGGGAGGAGG - Intergenic
930292826 2:49517328-49517350 CTCTGGGGAGAGAGAGATTAGGG - Intergenic
930722210 2:54648457-54648479 CTCTGCCCAGAGAAGGTAGAGGG + Intronic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
932421602 2:71604523-71604545 CAGGGGGCAGTGAGGGAAGATGG + Intronic
932605452 2:73162868-73162890 GTGGGGCCAGAGAGGGAAGAAGG + Intergenic
933144057 2:78829482-78829504 CTCAGGACAGAGTGGGAAGTAGG - Intergenic
933177387 2:79190915-79190937 CTATGGGTAGAGTGAGAAGATGG - Intronic
933420961 2:82044144-82044166 CTCTAGGCATTGTGGGAAGAGGG - Intergenic
933648467 2:84830787-84830809 CTCTGGGGTGAGGGGGAACAGGG + Intronic
935356863 2:102209467-102209489 CTCTAGGCAGAGAGAACAGAGGG + Intronic
935447782 2:103175033-103175055 CTATAGGCAGAGTTGGAAGAGGG - Intergenic
935552698 2:104475227-104475249 CTGTGGGGACAGAGGGAATATGG - Intergenic
936068423 2:109349474-109349496 CACTGGGCAGAGAAGCAAGTTGG - Intronic
936102089 2:109590956-109590978 CCCAGAGCAGAGAAGGAAGATGG + Intronic
936497124 2:113032087-113032109 CTCTGGGTTGAGAGGAAGGAGGG + Intronic
936631954 2:114213179-114213201 CTCAGGGAAGAGAGATAAGAAGG - Intergenic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937243963 2:120480382-120480404 ATCGGTGCAGAGAGGGATGACGG + Intergenic
937324418 2:120981785-120981807 AGGTGGGGAGAGAGGGAAGAAGG - Intronic
937553326 2:123122491-123122513 AACGGGGCAGAGAGGGAGGATGG + Intergenic
938320035 2:130356374-130356396 CGGGGGGCAGAGAGTGAAGACGG - Intronic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
938984545 2:136561334-136561356 TTCTGGGCAGAGAGAGATGCAGG - Intergenic
939501839 2:142996530-142996552 GTCTGGGCAGTGAAAGAAGAGGG + Intronic
940335583 2:152523945-152523967 TTATTGGCAGAGAGGGCAGAAGG + Intronic
942181865 2:173387894-173387916 CTTTGGACAGAGAGGTAAGGAGG + Intergenic
942402157 2:175614440-175614462 CTCTGGGCAGAGAGAGATGCAGG - Intergenic
943312350 2:186342333-186342355 CTTTAGGCAGAAAGAGAAGAGGG + Intergenic
943387146 2:187216071-187216093 TTGTGGGCAGAGTGGGAGGAGGG + Intergenic
945432892 2:209785479-209785501 CTCGGGGCTGAGAGGGAAGGAGG + Intronic
946114128 2:217446782-217446804 CTCTGGGCAGACAGACAAGTTGG + Intronic
946165926 2:217863829-217863851 GTCTGGGGATAGAGGGAGGAAGG + Intronic
946372973 2:219291629-219291651 CCCGGGGCAGAGAGGGAAGATGG + Intronic
946543055 2:220706962-220706984 CTCTGGGAGGAAAGGGCAGAGGG - Intergenic
946666958 2:222060471-222060493 TCATGGGCAGAGAGGGAAGGAGG + Intergenic
946907423 2:224430134-224430156 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
947227295 2:227852772-227852794 GTCTCAGCAGAGAGGGAAGCTGG + Intergenic
947714511 2:232332956-232332978 ATCTGGCCAGAGTGGGAGGAGGG - Intronic
948384776 2:237574705-237574727 CTCTGGACAGAGAGGAAGGAAGG - Exonic
949042102 2:241854216-241854238 CCATGGGCACAGAGGGAACAGGG - Intronic
1169207661 20:3749297-3749319 CTGTGGGCAGAGATGCAAGCAGG + Exonic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1170154184 20:13254633-13254655 CTCTGGGCAAAGGGAGAAGCTGG + Intronic
1170431728 20:16282595-16282617 TTCTGGGCAGAGCAGGAAGCAGG + Intronic
1171908565 20:30921258-30921280 CTTTGGGAAGCGAGGGAAGGTGG - Intergenic
1172042046 20:32052587-32052609 CTGGGGGCAGCGAGGGGAGACGG + Intronic
1172786025 20:37469484-37469506 CTCTGGGAAGCAAGGGAGGAGGG - Intergenic
1173176994 20:40771949-40771971 CTCTGGCCAGAGATGGAACTGGG + Intergenic
1173315744 20:41941576-41941598 CTCTGTTCAGAGAGAGATGAAGG - Intergenic
1173460992 20:43243281-43243303 CACTGGGCAGCGAGGGCAGATGG + Intergenic
1173730480 20:45325127-45325149 GTGGGGGCAGAGAGGTAAGAAGG - Intergenic
1173904165 20:46613763-46613785 CTCGGGGCAGAAGGGGAAGGAGG + Intronic
1173904177 20:46613793-46613815 CTCAGGGCAGAGGGGGAAGGAGG + Intronic
1173904190 20:46613822-46613844 CTGGGGGCAGAGGGGGAAGGAGG + Intronic
1174020826 20:47526771-47526793 CCATGGGGAGAGAGGGGAGAGGG + Intronic
1174289867 20:49500452-49500474 CTCTGGGCAGAGAAGGGCCATGG - Intergenic
1174327369 20:49790035-49790057 CTCTGGTCGGGGAGGGAAGTAGG - Intergenic
1174403395 20:50288462-50288484 CTCTGGGCACAGGAGGGAGATGG + Intergenic
1174423078 20:50413159-50413181 TTCTGGGCAGAGAGAGCAGCCGG + Intergenic
1174774486 20:53331497-53331519 CTCTGAGGGGAGAGGGGAGAGGG + Intronic
1175813330 20:61870477-61870499 CCCTGACCAGTGAGGGAAGAAGG - Intronic
1175889335 20:62309474-62309496 CTCTGGGGGCACAGGGAAGATGG + Exonic
1176453411 21:6884670-6884692 CTCGGGGCAAAGATGGAAGTTGG + Intergenic
1176831586 21:13749718-13749740 CTCGGGGCAAAGATGGAAGTTGG + Intergenic
1177774085 21:25549092-25549114 GTCTGGGGAGAGTGGGAAGCAGG - Intergenic
1177789885 21:25711390-25711412 CTATGGGCGTAGAGAGAAGATGG + Intronic
1178352287 21:31880868-31880890 CACTGGGCAGAGGGAGAAGCTGG + Intronic
1178634347 21:34289231-34289253 GTCTTGGCAGAAAGGGAAGGAGG + Intergenic
1179343894 21:40538186-40538208 CTCTGAGTGGAGAGGGCAGAAGG - Intronic
1180233824 21:46444266-46444288 CTCTGGGTGGAGAGGGAAAAGGG + Intronic
1180762492 22:18220762-18220784 CACTGCGCAGAGGGGGCAGAGGG + Intergenic
1180773175 22:18403846-18403868 CACTGCGCAGAGGGGGCAGAGGG - Intergenic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1180804530 22:18653395-18653417 CACTGCGCAGAGGGGGCAGAGGG - Intergenic
1180806220 22:18716015-18716037 CACTGCGCAGAGGGGGCAGAGGG + Intergenic
1180836154 22:18930510-18930532 CCCTGGGCAGTGAGTGTAGAGGG + Intronic
1181116119 22:20633379-20633401 AGTTGGGCAGAGAGGGAGGAGGG - Intergenic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181217167 22:21341796-21341818 CACTGCGCAGAGGGGGCAGAGGG + Intergenic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181438428 22:22923436-22923458 AGCTGGGCACAGAGGGAGGAGGG - Intergenic
1181540863 22:23572701-23572723 AGCTGGGCAGAGAGGAAGGAGGG + Intergenic
1181654653 22:24287021-24287043 CTGTGGCCAGAAAGGTAAGAGGG + Intronic
1181803285 22:25360741-25360763 ATCTGGGCAGTGAGTAAAGAGGG - Exonic
1181914339 22:26267527-26267549 CTCTGGGTAAAGAGGGAGTAGGG + Intronic
1181961013 22:26621912-26621934 TTATAGGCAGGGAGGGAAGAGGG - Intergenic
1182242976 22:28931928-28931950 CTATGGACAGAGAAGGCAGATGG + Intronic
1182595978 22:31420776-31420798 CTCTGGGCAGGAATGGAAGAGGG + Intronic
1182676562 22:32043657-32043679 CTGTGAGCAGAGAAGGAAGGTGG + Intronic
1182696209 22:32200774-32200796 AGCTGGGCAGAGAGAAAAGAGGG - Intronic
1182715898 22:32356123-32356145 AGCTGGGCAGAGAGAAAAGAGGG + Intronic
1182738238 22:32546577-32546599 CTCAGGCCAGAGAGGGTAGTTGG + Intronic
1183136023 22:35888625-35888647 CTCATGGCAGAAAGGGAAGAGGG + Intronic
1183261288 22:36797523-36797545 CTCTGGGTGGAGAGGGGAGAGGG + Intergenic
1183706258 22:39476493-39476515 CTCTGGCCATCCAGGGAAGATGG + Intronic
1184147300 22:42619190-42619212 CTCTGGCTAGAGTGGGAAGAGGG - Exonic
1184257335 22:43294737-43294759 CACGGGGCAGAGAAGGAGGAGGG - Intronic
1184765280 22:46569100-46569122 CCCTGCGCAGAGAAGCAAGAGGG + Intergenic
1185192348 22:49446904-49446926 CTCTGGGCGGAGAGGGGAAAGGG - Intronic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
1185336495 22:50272922-50272944 CACTGGGCAGTCAGGAAAGAAGG - Intergenic
1185367081 22:50441679-50441701 CCCTGGGGAGAGAGTGGAGAGGG + Intronic
1203235007 22_KI270731v1_random:144828-144850 CACTGCGCAGAGGGGGCAGAGGG - Intergenic
1203286246 22_KI270734v1_random:155809-155831 CCCTGGGCAGTGAGTGTAGAGGG + Intergenic
949227405 3:1711163-1711185 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
949382216 3:3459003-3459025 CTCTGGGCACTGGAGGAAGATGG + Intergenic
949539298 3:5019939-5019961 CTGTGGCCAGAGAGGAAAGGGGG - Intergenic
949672765 3:6418313-6418335 ATTTGGGCAGAGAGGTCAGAAGG + Intergenic
949675434 3:6447909-6447931 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
949694646 3:6680662-6680684 CTGTGGCCAGAGAGAGAAAATGG + Intergenic
950420175 3:12893799-12893821 CTCTGGGCTGAGCGGTGAGATGG + Intergenic
950426557 3:12927630-12927652 CTCAGAGCACAGAGGGAAGAGGG + Intronic
950478905 3:13232574-13232596 GTCTGGGGAGAGAGGGCAGGGGG + Intergenic
950542067 3:13618696-13618718 CTGGGGGCAGAGGGGGTAGAAGG - Intronic
950654059 3:14425709-14425731 CTCGGGGCAGGGAGGGTGGAAGG + Intronic
950730000 3:14948281-14948303 ATCCCGGCAGAGAAGGAAGAAGG - Intronic
950810831 3:15648371-15648393 CTCTGGCCTGAGAAGGAACATGG - Intergenic
951724609 3:25743312-25743334 TTGAGGTCAGAGAGGGAAGAGGG - Intronic
952255302 3:31690000-31690022 AGGTTGGCAGAGAGGGAAGAAGG + Intronic
952768561 3:36976699-36976721 CTCTCGGCTGAGAAGAAAGAGGG - Intergenic
952947323 3:38487062-38487084 CACCTGGCAGTGAGGGAAGATGG + Exonic
952970345 3:38646832-38646854 CACTTGACAGAGAAGGAAGATGG + Intronic
953449801 3:42996703-42996725 CTCTGGGCCTAGAGGGGAGATGG - Intronic
953905050 3:46864502-46864524 CTCTGGGCAGAGGGTGCAGTGGG - Intronic
954293989 3:49664101-49664123 CTTTGGGCAGAGAAGCAGGAAGG + Intronic
954469032 3:50675484-50675506 CTCTGTGCAGAGAGGGCGGCAGG + Intronic
955527447 3:59836013-59836035 CTATGGGGAGTGAGGGAAAATGG - Intronic
955536078 3:59925106-59925128 CTGTGGGGAGAGAGAAAAGAAGG - Intronic
955756629 3:62231282-62231304 TTCTGGGGAGAGAGGAGAGAAGG + Exonic
956427511 3:69152108-69152130 CTCAGGGAAGAGAGAGAATAGGG - Intergenic
957790868 3:84939672-84939694 CACAGGGCAGAGAGGGAAGAAGG + Intergenic
958870158 3:99548909-99548931 GCCTGGGCAAAGAGGGAAAAGGG - Intergenic
958921737 3:100114297-100114319 CACTGCCCGGAGAGGGAAGAGGG - Exonic
959537641 3:107504740-107504762 CATGGGGCAGAGAGGGAAAATGG + Intergenic
959693533 3:109224719-109224741 CTCTCAGCAGAGAGGGGAGCCGG + Intergenic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
959975557 3:112454776-112454798 CCCTGGGAATAGCGGGAAGAGGG - Intergenic
960945533 3:122963955-122963977 CCCTGGGGAGAGAGGGAGGGAGG - Intronic
960966812 3:123111231-123111253 CTCTGGATAAAGAGGGTAGAAGG - Intronic
961088377 3:124089731-124089753 GTCAGGGCAGTGAGGGAGGATGG + Intronic
961106318 3:124245138-124245160 CGCTGGGAAGAGAAGGGAGAAGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961666804 3:128497821-128497843 CTCTGGGGAGATAGGGAAAATGG - Intergenic
962474359 3:135742373-135742395 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
962669303 3:137689118-137689140 CTCTGGGCTTAGGGGGATGAAGG + Intergenic
962756117 3:138466819-138466841 CTCAGGGCAGAAGGTGAAGAGGG + Intronic
963378828 3:144503834-144503856 CTCTCAGCAGAGAGGGGAGATGG + Intergenic
963990326 3:151645961-151645983 CTCTGTGAACAGAGGGAATAGGG - Intergenic
964104432 3:153023796-153023818 CACTGGTCAGAGACTGAAGATGG - Intergenic
964421671 3:156510438-156510460 CTCGGGGCTGGGAAGGAAGAGGG - Intronic
964549200 3:157868029-157868051 AGCTGGGCAAAGAGTGAAGATGG + Intergenic
964920542 3:161890759-161890781 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
965039702 3:163490574-163490596 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
965123643 3:164595671-164595693 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
965684376 3:171286083-171286105 TGCTGGGGAGAGAGGGGAGAGGG + Intronic
965731542 3:171777442-171777464 CTCTGGGCAATTAGGAAAGAAGG - Intronic
966819044 3:183910692-183910714 CGCTGGTCTGAGAGAGAAGAGGG + Intergenic
966955779 3:184877079-184877101 CTCTGGGTAAAGAGAGAACAGGG - Intronic
967048908 3:185763976-185763998 GTGAGGGCAGAGAGAGAAGAGGG + Intronic
968077645 3:195825226-195825248 CTCTGGGGCCAGAGGGAAGCTGG - Intergenic
968600960 4:1509119-1509141 CTCTGGGCAGATGGGGGTGAGGG + Intergenic
968727895 4:2256708-2256730 CTCTGGGAGGAGAGGACAGAGGG + Intronic
968815352 4:2818755-2818777 CTCTGGGCAGGGAGGGGTCAGGG - Intronic
968850710 4:3075518-3075540 TTCTAGTCTGAGAGGGAAGAGGG + Intronic
968967098 4:3774279-3774301 CTCTCTGCAGAGTGGGAAGGGGG - Intergenic
969222774 4:5772316-5772338 CTCTTTGCAGGGAGGTAAGATGG - Intronic
969566523 4:7982011-7982033 CTGGGGCCAGAGAGGGGAGAAGG - Intronic
969575228 4:8032718-8032740 CGCCAGGCAGAGAGGGAGGAGGG + Intronic
969643453 4:8412798-8412820 CGCAGGGCAGCGAGGGAGGATGG - Intronic
969691261 4:8705407-8705429 GCCTGGGGAGAGAGGGAAGCTGG + Intergenic
970701504 4:18745969-18745991 CCAGGGGCTGAGAGGGAAGAAGG - Intergenic
971451755 4:26807313-26807335 CTCTGTCCAAGGAGGGAAGAAGG + Intergenic
971959824 4:33471348-33471370 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
976195463 4:82527661-82527683 CACTGGGCAGAGAGTTAGGAAGG - Intronic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976484726 4:85588384-85588406 GGCTGGGCAGAGAATGAAGAAGG - Intronic
976576347 4:86676851-86676873 GACTGGGCAGAGAGGGTAGAGGG + Intronic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
976768188 4:88620647-88620669 CTCTGTGGAGAGAGGGATTAAGG - Intronic
977220475 4:94332210-94332232 CTCTCAGCAGAGAGGGGAGCTGG - Intronic
978277400 4:106968183-106968205 ATGTAGGCAGAGAGGGAAAAAGG + Intronic
978879505 4:113684649-113684671 TTCTGGGCAGAAAGGCAAGATGG - Intronic
978919186 4:114161992-114162014 CCCCAGGCAGAGAGGGAAGAAGG + Intergenic
980122823 4:128745246-128745268 CTCTGGCCAGAGGGAGAAGGAGG + Intergenic
980729136 4:136804668-136804690 CTTTCAGCAGAGAGGGGAGATGG - Intergenic
980750324 4:137078735-137078757 CTCTGGGAAGAGAGGGGAGTAGG - Intergenic
981108394 4:140906819-140906841 CTCTAGTCTGAGATGGAAGAAGG + Intronic
981766549 4:148257136-148257158 TTCTGGGCAAAGTGGGTAGAGGG - Intronic
982193937 4:152890267-152890289 CACTGAGCAGGGAGGGAAGAAGG + Intronic
983697868 4:170554623-170554645 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
983981497 4:174002532-174002554 TACTGAGCAGGGAGGGAAGAGGG - Intergenic
984139010 4:175978519-175978541 GTCTGGCCTGAGTGGGAAGAAGG - Intronic
984766201 4:183402383-183402405 CACTGGGCAGAGAGGGAGGGTGG - Intergenic
985109822 4:186537269-186537291 GTCTGGGCGGAGAAGGAAAAAGG + Intronic
986164749 5:5263963-5263985 CTCTCAGCAGAGAGGGTAGCTGG + Intronic
986526222 5:8680242-8680264 TTTTGGGAAGAGAAGGAAGAAGG - Intergenic
986788789 5:11140616-11140638 ACATGGGAAGAGAGGGAAGAAGG + Intronic
986995762 5:13605383-13605405 CTTTGGGCAGCCAGGGCAGATGG - Intergenic
987486445 5:18532976-18532998 CTCTTAGCAGAGAGGGGAGCTGG - Intergenic
990376692 5:55177529-55177551 GTCTGGGCAGAATGGGAATAAGG - Intergenic
990683863 5:58278009-58278031 CTCTCAGCAGAGAGGGAAGCTGG - Intergenic
990998443 5:61757331-61757353 GTCTGGGAAGAGAGGGAAATGGG + Intergenic
991461423 5:66863373-66863395 GACTGGGCAGAGAAGGAATAAGG + Intronic
991470017 5:66957878-66957900 CCCTGGGCAAGGAGGGAAGTAGG - Intronic
991503691 5:67302961-67302983 CACTGGACAGAGAGGGAGAAGGG + Intergenic
991651703 5:68862297-68862319 CTCTGAGCAGAGAGGGGACCAGG - Intergenic
991656757 5:68912000-68912022 TTCTGGGCAGAGGAGGAATATGG - Intergenic
991770294 5:70034659-70034681 CTTTGGGCAGAGGTGGAAGGTGG - Intronic
991849589 5:70910078-70910100 CTTTGGGCAGAGGTGGAAGGTGG - Intronic
992519450 5:77535263-77535285 TTCTGTGCAGAAGGGGAAGATGG - Intronic
994188316 5:96839667-96839689 CTCTGAGCAGGGAGTGAAGGAGG - Intronic
994285319 5:97957571-97957593 AAGTGGGCAGAGAGGGAAAAAGG - Intergenic
994434024 5:99706039-99706061 TTCTCAGCAGAGAGGGAAGCTGG - Intergenic
994550164 5:101223923-101223945 GTCTGGGGAGAGTGGGGAGAGGG + Intergenic
997625719 5:135329418-135329440 GTCTGGCCAGAGAGTGAACAGGG + Intronic
997719920 5:136070100-136070122 CTCTGGGCTGGGAGGAAAGGGGG + Intergenic
997786787 5:136720874-136720896 ATCTGGGAAGAGAGATAAGAAGG + Intergenic
998015050 5:138725114-138725136 GCCTGGGGAGAGAGGGAAAAGGG + Intronic
998114703 5:139527281-139527303 CTGTGGGGAGAGGGGGAAGGGGG - Intronic
999333262 5:150692865-150692887 CTCTGGGCTAAGAAGGAAGATGG + Intronic
999910432 5:156192064-156192086 CTCTGGGAAAAGAGGAAAAATGG - Intronic
999973869 5:156891714-156891736 CTCTGTGCAGAGAGGAAATATGG + Intergenic
1000122317 5:158209009-158209031 CTGAGGGCAGAGAGTGGAGAGGG + Intergenic
1000770504 5:165347440-165347462 TTCTTGACAGAGAGGGAAGAGGG - Intergenic
1000989683 5:167898983-167899005 TTCAGGGAAGAGAGGCAAGAGGG + Intronic
1001088860 5:168722162-168722184 CTTTGGGCAGAGAGTGGGGAAGG + Intronic
1001434426 5:171688271-171688293 CTCTGAGAAGAGTAGGAAGATGG + Intergenic
1001557610 5:172647233-172647255 CTTAGAGCAGAGAGGGAAGAGGG + Intronic
1001753587 5:174149680-174149702 CTCTGTTCAGAGAGGGACAAGGG + Intronic
1002027005 5:176402576-176402598 CTCATGGCAGGGAGGGAAGGGGG - Intronic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002439172 5:179255529-179255551 GTGGAGGCAGAGAGGGAAGATGG - Intronic
1002679649 5:180950683-180950705 CCCTGAGCTGGGAGGGAAGAAGG + Exonic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1002930047 6:1627395-1627417 CTCTGGGCTGAGAAGGAATTAGG + Intronic
1003242120 6:4353927-4353949 GTGAGGGCAGAGAGGGAAGAAGG - Intergenic
1003586188 6:7391038-7391060 GTCTGGGGAAAGAGGGATGAAGG + Intronic
1003965522 6:11248957-11248979 CTCTGGGGAGAGAGAAGAGAAGG - Intronic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1004290127 6:14359129-14359151 TTCCTGGCAGAGAGGGGAGAAGG - Intergenic
1004331804 6:14728697-14728719 ATGTGGGCAGAGAAGGAGGAGGG + Intergenic
1004785168 6:18960531-18960553 CTTTGGGGAGAGAGAGAAAAAGG - Intergenic
1005463898 6:26093272-26093294 CCCAGGGCACAGTGGGAAGAGGG + Intronic
1006361419 6:33589389-33589411 ATCTGTGCAGAGAGGGCAGGAGG + Intergenic
1006583120 6:35088005-35088027 CTCTGTTCTGTGAGGGAAGAAGG - Intronic
1006729063 6:36222075-36222097 CTCCTGTCAGAGAGGGGAGAGGG + Intronic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1008043423 6:46827380-46827402 CTCTGGAGAGAAAGGGAAGATGG - Intronic
1008052141 6:46911118-46911140 CTCTCTACAGAGAGGCAAGATGG + Intronic
1008231738 6:48991015-48991037 TGCTGGGCAGAGTGGGCAGAAGG + Intergenic
1008444767 6:51575358-51575380 TTCTGGGCAGACAGGGAGAAAGG - Intergenic
1008858552 6:56121170-56121192 CTCATGGCATAGAGGGTAGAAGG + Intronic
1009370125 6:62889123-62889145 CCGTGGGAAGAGAGAGAAGAGGG + Intergenic
1010294723 6:74182722-74182744 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1010732365 6:79404593-79404615 CTCTCAGCAGAGAGGGAAGCTGG - Intergenic
1010972268 6:82275561-82275583 CTCTGTCCAGAGTGGGAGGAGGG - Intergenic
1011554562 6:88561200-88561222 CTCTTGGGAGAGGGGGAGGAAGG - Intergenic
1011714994 6:90096260-90096282 TTCTAGGCAGAGAGAGAAGCAGG - Intronic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1013389255 6:109666646-109666668 TTCTTGGCACAGTGGGAAGAAGG + Intronic
1013420521 6:109962589-109962611 CTGTGTTCAGAGAGGAAAGAGGG + Intergenic
1013582795 6:111552641-111552663 AGCTGGGGAGAGAGGGGAGAGGG - Intergenic
1013819299 6:114135594-114135616 CCCTGGGTGGAGAGGGAGGATGG - Intronic
1013932838 6:115555481-115555503 CTCTGGGAGATGAGGGAAGATGG - Intergenic
1014107407 6:117582673-117582695 CTCTCAGCAGAGAGGGGAGCTGG - Intronic
1015354034 6:132255906-132255928 CTCTGGGCAGGGCGTGGAGAGGG - Intergenic
1015701013 6:136036233-136036255 CTCTTATCAGAGAGGGAAAAAGG + Intronic
1015980276 6:138831418-138831440 CTATGGAGAAAGAGGGAAGAGGG - Intronic
1016039466 6:139417376-139417398 CTCTTGGAGAAGAGGGAAGAGGG + Intergenic
1016273423 6:142318711-142318733 ATCTGGGCAGAGAAGGGAGCAGG + Intronic
1016926225 6:149351115-149351137 CTCTGGGCTGAGGAGGAAGTGGG - Intronic
1017123302 6:151044243-151044265 CTCTGCCCAGAAAGGGCAGAGGG - Intronic
1018181405 6:161226599-161226621 CTCTGAGAAGTGAGAGAAGATGG - Intronic
1018200072 6:161386546-161386568 CCCTGGGCAGATATGGAACAGGG - Intronic
1018259048 6:161951385-161951407 CTCTGGCTAAAGAGAGAAGAAGG - Intronic
1018654772 6:166024757-166024779 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
1019301551 7:306754-306776 CTCCAGGCAGAGAGGGAACAAGG - Intergenic
1019302272 7:311846-311868 CTCCAGGCAGAGAGGGAACAAGG + Intergenic
1019323127 7:424605-424627 CTCGGGGCTGGGAGGGGAGAAGG + Intergenic
1019411425 7:908427-908449 CTCCGGGCAGTGAGGGGAGCAGG - Intronic
1019442221 7:1053153-1053175 CTCTGGGCACAGAGGCAAGCGGG + Intronic
1020958553 7:14773908-14773930 CTCTCGGCAAAGGGGGAAAAAGG + Intronic
1021770534 7:23996509-23996531 CTCGGGGCTGAGAGGGCAGCTGG - Intergenic
1021840326 7:24717133-24717155 CTGTGGGAAGAGAGGGAAAGAGG - Intronic
1022380910 7:29859224-29859246 GGCTGGGCAGAGGGAGAAGACGG + Intronic
1022515925 7:30974950-30974972 ACCTGGGGAGAGAGGAAAGAAGG - Exonic
1023039621 7:36160756-36160778 CTCTGGGGAGATGGGGAAGTGGG + Intronic
1023861631 7:44220498-44220520 CCCTGGGCACAGAGGGGACAGGG + Intronic
1024626923 7:51215801-51215823 CACAGGACAGAGAGGGATGAGGG + Intronic
1025035122 7:55589027-55589049 CTCAGGCCAGAGAGGAAAGGTGG + Intergenic
1025081551 7:55987796-55987818 AGCTGGGCAGAGAGGGAATACGG + Intronic
1026509954 7:71019484-71019506 CACTGGGAACAGAGGGGAGATGG - Intergenic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028513770 7:91653848-91653870 CTCAGGGAGGAGAGAGAAGATGG - Intergenic
1029730406 7:102434494-102434516 CTCAGGGCAGTGAGGGCTGAGGG - Intronic
1030077147 7:105746487-105746509 CTCTAGGCAGAGAGGGCACCAGG - Intronic
1030209992 7:106986657-106986679 CTCTTTGCAGGCAGGGAAGATGG + Intergenic
1033273627 7:139955252-139955274 CTCTGAGCAGTGACGGCAGAGGG - Intronic
1033451195 7:141463673-141463695 ATCTGAGCAGAGCTGGAAGAAGG + Intronic
1034065830 7:148135958-148135980 CATTGGGAAGAGAGGGAGGAAGG + Intronic
1034213385 7:149384108-149384130 CCCTGGGAAGAGTGGGAAGTTGG - Intergenic
1035076394 7:156180446-156180468 GTCAGGGCAGAGAGGGAATCAGG - Intergenic
1035266607 7:157693036-157693058 CCCTGGGCAGAGACAGAGGAGGG + Intronic
1035990859 8:4488801-4488823 CTCTTTGCAGAGAGGAAATATGG - Intronic
1036010544 8:4717075-4717097 CTCGGGGCAGAGAGGGAAGAAGG - Intronic
1037584276 8:20265791-20265813 CTCTGCGCAGAGCAGGGAGATGG - Intronic
1037885976 8:22596604-22596626 CTCAGTGCAGGAAGGGAAGAGGG - Intronic
1037928059 8:22860382-22860404 AGCTGGGGGGAGAGGGAAGAGGG - Intronic
1038364769 8:26919876-26919898 TTCTGGCAAGAGAGGAAAGAAGG - Intergenic
1038520353 8:28226985-28227007 CTCTCAGCAGAGAGGGAATGTGG - Intergenic
1038562950 8:28596424-28596446 CTCTCAGCAGAGAGGGGACACGG + Intergenic
1038650949 8:29402613-29402635 CTCTGGGGAGGGAGGAAAGGGGG + Intergenic
1039045907 8:33449200-33449222 CTGTGGGCACTGAGAGAAGAAGG + Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040547043 8:48406855-48406877 CTGAGGTCAGCGAGGGAAGATGG + Intergenic
1040960291 8:53024769-53024791 GACTGGGGAGAGAGGGAAGGAGG - Intergenic
1041465961 8:58157872-58157894 CTCAGGGAAGAGAGGTGAGATGG - Intronic
1041527424 8:58822885-58822907 CTCTAGGCAGAGAGAGTAAATGG - Intronic
1041527521 8:58823798-58823820 CTAGGGGCGAAGAGGGAAGAAGG + Intronic
1042507033 8:69571925-69571947 CTCTGGGTAGAGACAGATGACGG - Intronic
1042515872 8:69658484-69658506 CTCTGTGAAAAGAGAGAAGAAGG - Exonic
1042942123 8:74118381-74118403 AGGTGGGGAGAGAGGGAAGAAGG - Intergenic
1043687558 8:83106880-83106902 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1043692104 8:83167689-83167711 ATCATGGCAGACAGGGAAGAAGG - Intergenic
1044212242 8:89563293-89563315 ATCTAGGAAGAAAGGGAAGATGG - Intergenic
1044256845 8:90073509-90073531 ATCTGGGCAGAGGGAGAAGCTGG - Intronic
1044631023 8:94278697-94278719 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
1046104498 8:109649421-109649443 CTTGGGGCAGAGAGGGCAGTGGG + Intronic
1046747650 8:117893513-117893535 ATTTGGGCAGTGAGGCAAGAAGG + Intronic
1047141119 8:122140994-122141016 ATCTGGGATGAGAGGGAAGTTGG + Intergenic
1047207935 8:122818484-122818506 AACTAGGCAGAGAGGGAGGAGGG - Intronic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1048210401 8:132449939-132449961 CTCTGGACACAGTGGGAAGAGGG - Intronic
1048334052 8:133490094-133490116 CTTTGGGCAGAGAAGGAAGTTGG + Intronic
1048510658 8:135059221-135059243 GTCAGGGCTGAGGGGGAAGAGGG + Intergenic
1049333891 8:142071754-142071776 CTCTGCGCAGAGAGGGGCCACGG + Intergenic
1049399436 8:142418321-142418343 CGCAGGGCAGAGGGGGCAGAGGG + Intergenic
1049425088 8:142534373-142534395 CTCTGGGCAGAGTGAACAGAGGG + Intronic
1049470825 8:142774353-142774375 TTCTGGGCAGGGAGGGAAAGGGG - Intronic
1049561873 8:143316169-143316191 CTCAGGGCAGACAGGGAGGGTGG - Intronic
1049606964 8:143534237-143534259 CTCTGGCCTGGGAGGGAAGCAGG + Intronic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1050792831 9:9495644-9495666 CTCTCAGCAGAGAGGGGAGTCGG - Intronic
1050933796 9:11366903-11366925 GCGTGGGCAGAGAGGGGAGAGGG + Intergenic
1051282825 9:15460185-15460207 CTCTGGACAGAGAATGAATAGGG - Exonic
1051467660 9:17398915-17398937 TTTTTGGCAGAGAGGGAAGAAGG - Intronic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1052067517 9:24040566-24040588 CACAGAGCAAAGAGGGAAGATGG - Intergenic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053268172 9:36731156-36731178 TCCTGGGCAGAGAGGGAGGGTGG - Intergenic
1053274114 9:36770559-36770581 GGCTGGGCAGAGGGGGAAGGGGG + Intergenic
1054925496 9:70584829-70584851 CACATGGCAGAGAGGGAACAGGG - Intronic
1055135497 9:72824492-72824514 CTCTCAGCAGAGAGGGCAGTTGG + Intronic
1055447988 9:76402102-76402124 TTCCGGGTACAGAGGGAAGAAGG + Intergenic
1056373833 9:85987153-85987175 CTCTGGGGAGAGAGGCATGTTGG + Intronic
1056429830 9:86516371-86516393 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1057078374 9:92153408-92153430 TTCTAGGCAGAGAGAGAAGCAGG - Intergenic
1057312475 9:93951002-93951024 CTCTGGGCAGTGAGGGCACCTGG - Intergenic
1057472169 9:95367660-95367682 AGCTTGGCAGACAGGGAAGAAGG + Intergenic
1057503984 9:95617829-95617851 CCTTGGGGAGAGACGGAAGAGGG + Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059287267 9:113185335-113185357 TTGTGGGAAGAGAGGAAAGAGGG + Intronic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1059898622 9:118896403-118896425 CTCTGGGCAGAGGGAGGAGATGG + Intergenic
1059989099 9:119847833-119847855 CTCAGAGCAAATAGGGAAGATGG - Intergenic
1060374336 9:123105229-123105251 CACCAGGCAGAGATGGAAGAGGG + Intergenic
1060507485 9:124209012-124209034 CTCTGGGAAGAGAAGGGACATGG - Intergenic
1060601423 9:124880731-124880753 CTCTGAGCAGAGCAAGAAGATGG + Intronic
1060745457 9:126127982-126128004 CTCTGGGCACTGAAAGAAGAGGG + Intergenic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1060804010 9:126563704-126563726 CTCTGTACAGAGAGGGAAACAGG - Intergenic
1060982331 9:127800565-127800587 CCCTGGGGAGACAGGGAAGGAGG + Intronic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1061370727 9:130196001-130196023 CTCTGGGAGGAGGGGGAAAATGG + Intronic
1061512398 9:131069102-131069124 CTCTGGGCAGAGATGACTGATGG + Intronic
1061736682 9:132665550-132665572 CTCTGAGCAGAGAGGGAGCAAGG + Intronic
1061906680 9:133702713-133702735 ATCTCGGCACAGAGGGAGGAGGG + Intronic
1061939394 9:133875963-133875985 CGCTGGGCAGTGAGTGAATAAGG - Intronic
1061988695 9:134145685-134145707 CCCTGGCCAGAGAGGGGACAGGG - Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062254556 9:135614866-135614888 CCCTGGTCAGGGAGGGCAGAGGG - Intergenic
1062255811 9:135620070-135620092 GACTGGGCAGACAGGGGAGACGG - Intergenic
1062438283 9:136556806-136556828 CTGTGGGCTGTGGGGGAAGAAGG - Intergenic
1062573408 9:137195692-137195714 AGCTGGGCAGAGAGCCAAGAGGG + Intronic
1062631634 9:137465626-137465648 TTCTGAACAGAGAGGGGAGAAGG + Intronic
1062694895 9:137868786-137868808 CTCTGGGCAGGTGGGGAAGGGGG + Intronic
1203771939 EBV:53932-53954 CTTTGGGCGGGGAGGGAAGCAGG + Intergenic
1185494889 X:546888-546910 CTCTGGGCAGAAATGGGATAAGG - Intergenic
1185877422 X:3712644-3712666 CTCTGGGCACACAGGGAGGCTGG + Intronic
1186020607 X:5251177-5251199 GGCAGGGGAGAGAGGGAAGAAGG + Intergenic
1186239001 X:7546463-7546485 CTCTCAGCAGAGAGGGAAGCTGG - Intergenic
1186307385 X:8277049-8277071 CACTGGGAAGAGAGAGAAGTGGG + Intergenic
1186334302 X:8570195-8570217 CTATGGCCAGACAGGTAAGATGG + Intronic
1186398933 X:9238789-9238811 TTTTGGGTAGAGGGGGAAGATGG + Intergenic
1187146195 X:16639602-16639624 CACTGGGCAGTGGGGGAAGAGGG - Intronic
1187410644 X:19048025-19048047 CTTTGGCCAGAACGGGAAGAAGG + Intronic
1188180599 X:27050658-27050680 CTCTCAGCAGACAGGGAAGCTGG - Intergenic
1188495491 X:30779429-30779451 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1189836025 X:45023789-45023811 CTCGGGGAAGAGAGGCAAGGGGG - Intronic
1190491886 X:50990624-50990646 CTGAGGGCAGAGAGGGAGGCAGG - Intergenic
1190501276 X:51081056-51081078 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1191214167 X:57918829-57918851 CACTGAGCAGAAGGGGAAGAAGG - Intergenic
1191670626 X:63745267-63745289 CTCTGGGCCCTGAGGGTAGATGG + Intronic
1191716105 X:64194619-64194641 ATCTGGGAGGAGAGGGGAGAGGG + Intronic
1191754274 X:64577244-64577266 CTCTCAGCAGAGAGGGGACACGG - Intergenic
1191955278 X:66637321-66637343 CTAGGGGCAGAGAGGGAACAAGG - Intronic
1192036398 X:67567480-67567502 CTCCGTGCAGAGATGGAAGTGGG + Intronic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1192953595 X:76044298-76044320 CTCAGGCCAGAGAGGGAATGAGG - Intergenic
1193737480 X:85175955-85175977 CTGAGGGCAGAGAGCAAAGATGG + Intergenic
1195347086 X:103962000-103962022 GTCTGTGCAGAGAGAAAAGATGG - Intronic
1195360356 X:104076841-104076863 GTCTGTGCAGAGAGAAAAGATGG + Intergenic
1197926061 X:131647696-131647718 CACTGTGCAGAGAGGGAAAAGGG - Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198222258 X:134613375-134613397 CTATGGGCAGAGGCGGAGGAAGG + Intronic
1198713836 X:139534944-139534966 GTCTGGGAAGAGAAGGATGAAGG + Intronic