ID: 1198141034

View in Genome Browser
Species Human (GRCh38)
Location X:133803607-133803629
Sequence ATGAAAAATAGGTCTGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198141030_1198141034 27 Left 1198141030 X:133803557-133803579 CCAAGACATAGTCAAAGGGGAAA 0: 1
1: 0
2: 1
3: 15
4: 199
Right 1198141034 X:133803607-133803629 ATGAAAAATAGGTCTGATTCAGG 0: 1
1: 0
2: 0
3: 14
4: 229
1198141032_1198141034 -10 Left 1198141032 X:133803594-133803616 CCATCTGTCTCAAATGAAAAATA 0: 1
1: 0
2: 3
3: 93
4: 763
Right 1198141034 X:133803607-133803629 ATGAAAAATAGGTCTGATTCAGG 0: 1
1: 0
2: 0
3: 14
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198141034 Original CRISPR ATGAAAAATAGGTCTGATTC AGG Intronic
901394729 1:8972735-8972757 ATCACAAATAGGCCTTATTCGGG - Intronic
901591537 1:10348213-10348235 ATGAAACATAGGTCCGCTTTTGG + Intronic
902222922 1:14978203-14978225 TTGAAGAAAAGCTCTGATTCAGG - Intronic
902768115 1:18630389-18630411 ATGAGAAATAGGGCGGACTCTGG + Intergenic
903196104 1:21689486-21689508 ATGAAAACTAGATCTGTATCTGG + Intronic
906076882 1:43058504-43058526 CTGAAAAACAGGTCTGTTGCTGG + Intergenic
906987221 1:50696280-50696302 AGGAAAATTAGGCCTGTTTCTGG - Intronic
907448061 1:54522186-54522208 ATGAAAACTATGGCAGATTCTGG + Intergenic
907588863 1:55646585-55646607 TTTAAAAATAGTTTTGATTCGGG - Intergenic
908193930 1:61730058-61730080 AGGAAAAATTGGTCTGTTTGGGG + Intergenic
909803240 1:79841261-79841283 ATGAATAATAGATTTGATTTTGG + Intergenic
910312687 1:85843035-85843057 ATGAAATATAGGACTTTTTCAGG - Intronic
911902956 1:103528233-103528255 TTGAAAAATAGATTTGAGTCTGG + Intronic
913237938 1:116800957-116800979 ATGAAAGATAGGTTTGATGGAGG + Intergenic
917459007 1:175211917-175211939 GTGAAAAATAGGACTCATACTGG + Intergenic
918378157 1:183929686-183929708 AAGAAAAAGAGGTTTGAGTCAGG - Intergenic
919354005 1:196498224-196498246 AGGAAAAATAATTCTGATCCAGG + Intronic
920407273 1:205725877-205725899 ATGAAAAATAGTTCTGAGTTGGG + Intronic
920751421 1:208681268-208681290 AAAAAAAAAAGGACTGATTCAGG - Intergenic
921508109 1:215999024-215999046 AAGAAAAATAAGTGGGATTCTGG - Exonic
1063139211 10:3241523-3241545 GTGAAATATAGTTGTGATTCTGG + Intergenic
1066011528 10:31198667-31198689 ATGATACATGGGTCTGTTTCAGG - Intergenic
1068176737 10:53469364-53469386 ATTAAAAATAGGTTTTATCCTGG - Intergenic
1069430629 10:68331565-68331587 GTGAAAAATAGGAGTGTTTCTGG - Intronic
1070352148 10:75602793-75602815 ATTAAAAAAAGTTCAGATTCAGG + Intronic
1072524428 10:96259038-96259060 TTCAAAATCAGGTCTGATTCCGG + Intronic
1072579976 10:96732616-96732638 ATGTAAAAGAAGTCTGATACAGG + Intergenic
1073224671 10:101907754-101907776 CTGAAAAACAGGCCTGACTCTGG - Intronic
1076303263 10:129444191-129444213 TTGAAAAATAGGTTTGTTACTGG - Intergenic
1076352690 10:129828867-129828889 ATGAATAGGAGGTCTGTTTCTGG + Intergenic
1080113249 11:28593510-28593532 ATAATAAATAGGGCTGATTTGGG - Intergenic
1081368188 11:42262637-42262659 ATTAAAAATATGTCTTACTCTGG - Intergenic
1081823143 11:46020335-46020357 ATGAAAAATTGGTTTGCTGCAGG - Intronic
1083037777 11:59656383-59656405 ATAAAAAATAGGTATAATTTAGG + Intronic
1085341297 11:75733261-75733283 GTGCAAAAGAGGGCTGATTCAGG - Intergenic
1087581807 11:100065406-100065428 ATGAAAAATAGATGAGAGTCAGG + Intronic
1091737109 12:2931986-2932008 ATGCAAAATAGGTTTGAATTTGG - Intronic
1095255100 12:40025525-40025547 CTAATAAATAGGTCTGATTCTGG - Intronic
1096039811 12:48504377-48504399 ATGCTAGATAGGTCTGAATCAGG + Intergenic
1099019201 12:77382160-77382182 AGAAAATATAGGCCTGATTCTGG + Intergenic
1099558302 12:84140212-84140234 ATGAAAATAAGGAATGATTCTGG + Intergenic
1100389785 12:94138418-94138440 ATGGAAAATAGGTGTGTTACAGG + Intergenic
1101796421 12:107978921-107978943 AAAAAAAATTGCTCTGATTCTGG + Intergenic
1103016550 12:117499161-117499183 TTGAAAAATAAGTGTGGTTCTGG - Intronic
1103165480 12:118766820-118766842 TTGAAAAACAGGGCTGACTCTGG + Intergenic
1106818120 13:33432081-33432103 AGGAAAAATAGGGGTGATTAAGG + Intergenic
1107035194 13:35894783-35894805 ATGAACAAGAGCTCAGATTCTGG + Intronic
1109017468 13:57036432-57036454 ATGTAAGATAGGATTGATTCTGG - Intergenic
1109961339 13:69636612-69636634 ATGAACAATAAGTCTGAGTGTGG - Intergenic
1111346402 13:86960628-86960650 ATGAAAAAAATGTGTGATTTGGG - Intergenic
1112175034 13:97014006-97014028 ATGTTAAATAGGTGTGAGTCTGG - Intergenic
1114447258 14:22798471-22798493 AAGAAAAAGAAGTCTGACTCAGG + Intronic
1115185470 14:30683424-30683446 GTGAAAAGGTGGTCTGATTCAGG + Intronic
1115406380 14:33021608-33021630 TTGAAAAATAGGTGGGATTTAGG - Intronic
1115777990 14:36737280-36737302 ATTAAAAAGAGGTGTGATGCAGG + Intronic
1115874182 14:37842210-37842232 TGGTAAAATAGGTCTGATTGAGG + Exonic
1115941142 14:38611146-38611168 ATGAAAAATAGGCCAGATGTGGG + Intergenic
1118673578 14:68158047-68158069 ATGAATAATAGGCCACATTCAGG + Intronic
1119502526 14:75142478-75142500 TTGAAAGATAGGTCAGATTTGGG - Intronic
1121890574 14:97586726-97586748 ATGAAATATGGGACTGAATCAGG + Intergenic
1121996874 14:98609349-98609371 ATGAATATTAGCTGTGATTCTGG - Intergenic
1124556667 15:30732115-30732137 ATGGCACATTGGTCTGATTCAGG + Intronic
1124674612 15:31673622-31673644 ATGGCACATTGGTCTGATTCAGG - Intronic
1126194253 15:45913754-45913776 ATGACAAATAGGGCTTATTAAGG - Intergenic
1128200609 15:65803570-65803592 ATTAAAAACAGGGCTCATTCAGG + Intronic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133643188 16:7737787-7737809 CTGAAAAAAAGATCTGGTTCAGG - Intergenic
1134208414 16:12256273-12256295 TTGCAAAATAGGTCTGATAAGGG - Intronic
1136739089 16:32496975-32496997 ATGAAAAAAAGATTTAATTCTGG - Intergenic
1138130445 16:54474936-54474958 TAGTAAAATAGGTCTGTTTCAGG - Intergenic
1138986614 16:62336798-62336820 ATGAGAAATAGGTTTGTTTTTGG + Intergenic
1140904379 16:79397883-79397905 GTGACCAATAGGCCTGATTCTGG + Intergenic
1203012296 16_KI270728v1_random:307299-307321 ATGAAAAATAGTTTTAACTCTGG - Intergenic
1203013387 16_KI270728v1_random:323569-323591 ATGAAAAAAAGGTTTAACTCAGG - Intergenic
1203014124 16_KI270728v1_random:334817-334839 ATGAAAAAAAGATTTAATTCTGG + Intergenic
1203030631 16_KI270728v1_random:580458-580480 ATGAAAAATAGTTTTAACTCTGG - Intergenic
1203031722 16_KI270728v1_random:596728-596750 ATGAAAAAAAGGTTTAACTCAGG - Intergenic
1203032459 16_KI270728v1_random:607976-607998 ATGAAAAAAAGATTTAATTCTGG + Intergenic
1203039999 16_KI270728v1_random:737703-737725 ATGAAAAAAAGGTTTAACTCAGG + Intergenic
1203041090 16_KI270728v1_random:753973-753995 ATGAAAAATAGTTTTAACTCTGG + Intergenic
1142846652 17:2683079-2683101 CTGAAAACTAGGTCTGACTCTGG + Exonic
1144182872 17:12769413-12769435 TTAAAAACTAGGTCTTATTCAGG - Intergenic
1147286453 17:39406141-39406163 TGGAGAAATAGGTCTGAGTCTGG - Intronic
1152180276 17:78815685-78815707 ATGAAAAATTGGTCAGTTTTGGG - Intronic
1152346320 17:79754406-79754428 ATGATTAATGGGTCTCATTCTGG - Intergenic
1153464192 18:5370777-5370799 ATGCAAAATATGTGTCATTCTGG - Intergenic
1156848530 18:41698638-41698660 AAGAAAAGTAGGTTTGATGCTGG + Intergenic
1158559761 18:58504130-58504152 AAGAAAAATAGGAATGATCCTGG + Exonic
1162613564 19:11776494-11776516 ATGACAAAAAGGTCTGTTTAGGG + Intronic
1168393886 19:56032351-56032373 AAAAAAAAAAGATCTGATTCAGG + Intronic
926414201 2:12633057-12633079 ATGAAACCTAGGTTTGAGTCTGG + Intergenic
926871197 2:17419719-17419741 GTGAAAAATAGGTCAGAATAGGG - Intergenic
928193929 2:29199561-29199583 ATTAAAAACAGGTCTGTTTCTGG + Intronic
928522034 2:32098558-32098580 GTTAAAAATAGGCCTTATTCAGG - Intronic
929357128 2:41039198-41039220 TTGAGAAACAGGACTGATTCTGG - Intergenic
930514511 2:52389149-52389171 ATGAAAAATGGGTTAGATGCTGG + Intergenic
932083624 2:68738033-68738055 AGGATCAATAGGTCAGATTCAGG - Intronic
932225620 2:70037950-70037972 CTGAAACCTAGGTCTGTTTCTGG + Intergenic
933563056 2:83913256-83913278 ATGAAAAAGCGGTGTGATGCGGG + Intergenic
933796248 2:85922194-85922216 GGGAAAAATGGGTCTGACTCTGG - Intergenic
933971437 2:87473067-87473089 ATAAAAAATAGGCCTGATTGGGG + Intergenic
935595671 2:104875421-104875443 ATGAAAAATGGTGCTGCTTCTGG - Intergenic
936322293 2:111477132-111477154 ATAAAAAATAGGCCTGATTGGGG - Intergenic
936661203 2:114546107-114546129 ATGAAAAAATGGACTGATACAGG - Intronic
937662852 2:124450863-124450885 TTGAAAAATATATATGATTCAGG + Intronic
938663912 2:133514210-133514232 ATGAAAAATATGTTTCATTGTGG - Intronic
939466186 2:142561087-142561109 ATGAAAACTAGGTAAGATTGAGG + Intergenic
939567354 2:143800741-143800763 AAGAAAAATAGAGATGATTCTGG + Intergenic
940016485 2:149111399-149111421 ATGAAAAATCAGTCTGATTTGGG + Intronic
943053035 2:182939593-182939615 ATTAAAAGTAGGTCTGAATTGGG - Intronic
944045482 2:195406480-195406502 ACCAAAAATGAGTCTGATTCAGG - Intergenic
945172969 2:207016039-207016061 AAGAAAAAGACGTGTGATTCAGG + Intergenic
945905968 2:215593812-215593834 ATGACAAAAATGTCTGCTTCTGG - Intergenic
946842461 2:223832089-223832111 ATCAAAAAAAGGACTTATTCTGG + Intronic
1170322343 20:15114162-15114184 ATGAGACAGAGGTCTGATGCAGG - Intronic
1173288159 20:41691417-41691439 ATGAGAAACAGGTTTAATTCTGG - Intergenic
1174702361 20:52621718-52621740 AAGAAACATATGTCTGTTTCAGG - Intergenic
1175092958 20:56519922-56519944 ATGCAAAATAAAACTGATTCAGG - Intronic
1175220381 20:57413260-57413282 ATGTAAAATAAGTCTGAAGCAGG + Intergenic
1177297094 21:19189233-19189255 ATCAAAAATAAGTCTGCTACTGG - Intergenic
1177601483 21:23320397-23320419 ATGAAATAAATATCTGATTCAGG - Intergenic
1178974160 21:37207725-37207747 ATGCAAAGCAGGTCTGTTTCAGG + Intergenic
1181463352 22:23097992-23098014 ATGAAAAACTGGACTGACTCAGG - Intronic
1181496758 22:23291674-23291696 ATGAATAATAGGTTTGGTTTGGG - Intronic
1203236152 22_KI270732v1_random:3222-3244 ATGAAACCTACGTCTGATTGGGG + Intergenic
949163421 3:909392-909414 ATGAAGAATAGGGCTGACTGGGG + Intergenic
949388057 3:3527059-3527081 ATGAAGAATATGTCTGCTCCTGG + Intergenic
949461716 3:4301969-4301991 CTGAAAAGTGGGTGTGATTCAGG - Intronic
949838239 3:8292251-8292273 ATGAAAAATGGAATTGATTCTGG - Intergenic
951800921 3:26595356-26595378 ATGAAAAATAGGGTCAATTCTGG + Intergenic
952048424 3:29353142-29353164 GTGATAAATATGTCTGATTCTGG + Intronic
952278483 3:31900947-31900969 ATGAAAAATAAATTTGATTAAGG + Intronic
952988247 3:38807166-38807188 ATGAAGTATAGTTTTGATTCAGG + Intergenic
956685270 3:71820894-71820916 AAGATCAAAAGGTCTGATTCAGG - Intergenic
957538298 3:81534199-81534221 ATGAAAAAAATGACAGATTCAGG - Intronic
957544843 3:81623964-81623986 ATTAAAAATAAGTCTGGGTCAGG - Intronic
958094689 3:88928818-88928840 ATGGAAAATAGGTCAGATCCTGG - Intergenic
958598795 3:96266384-96266406 ATGAAAAAGATGTCTAAATCAGG + Intergenic
958705726 3:97652570-97652592 ATCAAAAATAGGTTTGAGTGGGG + Intronic
959736351 3:109663311-109663333 ATGAAAAAAAGGTCTCAGGCTGG - Intergenic
960151339 3:114251679-114251701 CTGAAAAATAGGCCTTAATCAGG + Intergenic
961066316 3:123880288-123880310 ATGTATAGTAGGTCTCATTCAGG - Intronic
961249031 3:125484184-125484206 ATAGAAAATATGGCTGATTCAGG - Intronic
963724876 3:148908731-148908753 AGTAAGAATAGGGCTGATTCTGG + Intergenic
964959401 3:162404888-162404910 TTGGAAAATAGGTCTAATTGCGG + Intergenic
966667417 3:182487571-182487593 GTGACAAACAGGCCTGATTCAGG - Intergenic
966935199 3:184703051-184703073 CTGACAAATGGGTCCGATTCTGG + Intergenic
967858063 3:194133338-194133360 TTGAAAAATAGGTAGGATTGGGG - Intergenic
972156700 4:36171953-36171975 ATGAAAAATAGGCATGAGCCAGG + Intronic
973092432 4:46155233-46155255 ATGAAAGCTAGGACTGAGTCTGG - Intergenic
973537621 4:51899531-51899553 TTGAAAACTAAGTTTGATTCTGG + Intronic
973690985 4:53431340-53431362 ATGAAAGAAAGCTATGATTCAGG + Intronic
973754472 4:54061079-54061101 ATAAAAAGTAAGTCTGATTTGGG + Intronic
973913630 4:55610171-55610193 ATGAAAAAGAGGTCGGGTGCAGG + Intronic
974841431 4:67303826-67303848 ATTAAAAAGAGTTTTGATTCTGG + Intergenic
975176951 4:71300046-71300068 ATGAAAAATGGGTTTGATTAAGG - Intronic
975795640 4:78004208-78004230 ATGAAAAACAGATATGATTAAGG - Intergenic
977722211 4:100252476-100252498 ATGAACAATAGGTAGGATTTAGG + Intergenic
979231818 4:118354981-118355003 ATGGAAATTGGGTCTGCTTCTGG - Intergenic
979565535 4:122150761-122150783 ATGAAAAATAGGTGGGAGACTGG + Intergenic
979589127 4:122458189-122458211 ATGAAGAAAAGGTCAGATTAGGG + Intergenic
979868216 4:125782483-125782505 ATCAAAAATAGGACTGAGTGTGG + Intergenic
981894588 4:149783205-149783227 ATGAAGAATAGGTTTTATTGTGG - Intergenic
982062886 4:151622454-151622476 AAGAAAAAGAGGTCTGGTGCTGG - Intronic
982717352 4:158822921-158822943 ATGGACAATTGTTCTGATTCAGG - Intronic
982910726 4:161138819-161138841 ATGTAAGATAAGTCTGATACTGG - Intergenic
983664953 4:170171024-170171046 ATGTAAAATATGTGTGATTGAGG + Intergenic
984206873 4:176795619-176795641 ATGTAAAAGAGGTGTTATTCTGG - Intergenic
984409971 4:179385252-179385274 ATGAAATATATGTTTAATTCTGG - Intergenic
985066994 4:186132371-186132393 TAGACAAATAGGTCTGTTTCTGG - Intronic
988447458 5:31304048-31304070 AGGAAAAGTAGGTCTGCTTTTGG - Intronic
988948963 5:36239024-36239046 ATGTAAAACAGGTCTGTTTTAGG - Intronic
990548917 5:56852695-56852717 ATTTAAAATAGGTATGTTTCTGG + Intronic
990756828 5:59081403-59081425 CAGAAAAATAGGTCTGGTTTTGG + Intronic
993830753 5:92754873-92754895 ATGAAAAATAGGTTTTTATCAGG + Intergenic
993835184 5:92811136-92811158 ATAAAAAAGAGGTCTGAAACTGG + Intergenic
994023468 5:95054568-95054590 ATCAAAAATGAGTCTGATCCAGG - Intronic
994069708 5:95587213-95587235 AAGAAAATTCGGTATGATTCTGG - Intronic
995346371 5:111123838-111123860 ATGAAAAATGGTGCTGATTTGGG - Exonic
996391238 5:122964271-122964293 AAGAACAATAGTTCTGAATCAGG + Intronic
998068799 5:139180422-139180444 AGGAGAAAAAAGTCTGATTCAGG - Intronic
998827682 5:146120585-146120607 ATGAAAGACAGATCTAATTCTGG + Intronic
999215762 5:149933623-149933645 TTGAAAAATAGGGATGATTATGG - Intronic
1002707048 5:181168849-181168871 ATGAAAAATTGGTTTGCTTTAGG + Intergenic
1003087249 6:3069527-3069549 ATAAAAAAGAGCTCTGATTAAGG - Intronic
1004678632 6:17869896-17869918 CTGACAAATAGGTCGGTTTCAGG + Intronic
1005894944 6:30170058-30170080 ATGAAAAAAACTCCTGATTCTGG - Intronic
1008821510 6:55637430-55637452 ACGAAAAATTGGTCTGTTTTGGG + Intergenic
1010605030 6:77878085-77878107 TTGAAAGATTGGTTTGATTCAGG + Intronic
1011260300 6:85463420-85463442 ATAAAAAAAAGATCTGATTTAGG + Intronic
1011351750 6:86431821-86431843 AAGAACAATAGGTCTGAGGCAGG + Intergenic
1011599272 6:89044863-89044885 TTGAAAAATAGGTCAGCTTCAGG - Intergenic
1011905651 6:92364149-92364171 AACAAAAATATTTCTGATTCAGG - Intergenic
1015236941 6:130981695-130981717 GGGAAAAATAGCTCTGCTTCTGG - Intronic
1016870498 6:148811488-148811510 TTTAAAAATTGGTCTCATTCTGG + Intronic
1017580935 6:155864656-155864678 ATGAAAAATAGCCATGAATCTGG - Intergenic
1018049781 6:159998805-159998827 ATGCAAATTAGATTTGATTCGGG - Intronic
1021395320 7:20140370-20140392 ATGAAAAATGGGGGTGATGCTGG + Exonic
1021993104 7:26155150-26155172 AAGAAAAATAGGGCTGAGTGCGG + Intronic
1022493415 7:30837972-30837994 AGGAAAAAAAGAGCTGATTCTGG + Intronic
1022835657 7:34111489-34111511 ATGGAAAATAAATCTGATTTGGG + Intronic
1023016471 7:35972382-35972404 ATGAAACATACCTCTGCTTCTGG + Intergenic
1023601398 7:41884988-41885010 AGTAAAATTTGGTCTGATTCCGG + Intergenic
1024712353 7:52030647-52030669 ATGAGTAATATATCTGATTCTGG + Intergenic
1025550676 7:62243933-62243955 ATGAAAAAAAGATTTAATTCTGG - Intergenic
1026192321 7:68140572-68140594 TTGAGAAATAGCTCTGCTTCTGG - Intergenic
1027746108 7:82076125-82076147 GTGAAAAATAAGACAGATTCAGG + Intronic
1027879711 7:83818857-83818879 AGGAAAAACAGGTCTGTTTTAGG + Intergenic
1028684979 7:93582077-93582099 ATGGAAAGTAGGACTAATTCTGG + Intergenic
1029328369 7:99829754-99829776 ATGAAAGATAGGTCTGTATATGG - Intronic
1030429665 7:109428453-109428475 ATTAAAAATATGGCTGATTCTGG + Intergenic
1030464856 7:109888322-109888344 ATGAAAATTAAGTCTGTGTCAGG - Intergenic
1032998200 7:137471748-137471770 AGGAAAAAATGGTCTCATTCAGG + Intronic
1033649265 7:143328481-143328503 ATTAAAATTAGCTCTCATTCCGG + Intronic
1035130489 7:156648183-156648205 ATGGAAAATAGGTTTGGTTGAGG + Intronic
1035772643 8:2160901-2160923 ATTAAAAATATGTCTTATGCTGG + Intronic
1037075240 8:14707911-14707933 ATGGAAAATGGGTATGATTTGGG + Intronic
1037601278 8:20396320-20396342 ATGTAAAATATGTATGATTATGG - Intergenic
1038837663 8:31145757-31145779 ATGAAGAATATTTGTGATTCAGG + Intronic
1043399856 8:79873323-79873345 AAAAAAAATAGATCAGATTCTGG - Intergenic
1043644831 8:82504226-82504248 ATGAAAAATATTTCTGATTTTGG - Intergenic
1044390335 8:91642649-91642671 TTGTAAAATACGTCTCATTCTGG + Intergenic
1046546190 8:115653066-115653088 AGGCAAAATAGCTCTTATTCTGG - Intronic
1046760730 8:118017452-118017474 AAGAAAGCTAAGTCTGATTCAGG + Intronic
1047534187 8:125704239-125704261 ATGAAAAATGGGTCAGATAGAGG - Intergenic
1048131096 8:131698463-131698485 GTAAAAAAAAGGTCAGATTCTGG + Intergenic
1048443020 8:134473896-134473918 ATGACCCATAGGTCTGATTCTGG + Intergenic
1050183062 9:2941391-2941413 AATAAAAATTGGTGTGATTCTGG + Intergenic
1050590009 9:7150838-7150860 ATTAGAAATAGGTGAGATTCTGG - Intergenic
1050964057 9:11774757-11774779 ATGAAAAGTAGGTCAAATACAGG - Intergenic
1051796357 9:20875726-20875748 TTGAAAAATATGTTTGATTGTGG + Intronic
1055932853 9:81577304-81577326 ATGAAAAATAATTATGATCCTGG + Intergenic
1057025111 9:91729023-91729045 ATGAAAAAAATGTATGATTTTGG - Intronic
1058296184 9:103310759-103310781 AGGAAGGATAAGTCTGATTCTGG + Intergenic
1058445041 9:105047407-105047429 ATGAAAAATAGGAATCATACTGG - Intergenic
1058677546 9:107413276-107413298 AGGAAATATAGTTCTGGTTCCGG - Intergenic
1191641959 X:63435984-63436006 ATGAAAAAAAATTCTGAATCTGG + Intergenic
1192435385 X:71140370-71140392 ATGAAAAATAGGGCTGGGTGCGG - Intronic
1194603302 X:95950123-95950145 ATGAAAATTAATTCTGATTAGGG - Intergenic
1194943953 X:100046277-100046299 ATAAAAAATAGGTATGAAACTGG - Intergenic
1195604547 X:106790176-106790198 ATGGAAAATATGGCTAATTCAGG - Exonic
1196711087 X:118763883-118763905 ATAGAAAATAGTTCTGATTTAGG - Intronic
1198141034 X:133803607-133803629 ATGAAAAATAGGTCTGATTCAGG + Intronic
1201142754 Y:11042077-11042099 ATAAACCATGGGTCTGATTCAGG - Intergenic