ID: 1198142400

View in Genome Browser
Species Human (GRCh38)
Location X:133817616-133817638
Sequence CAGGACTCCTGGGGAAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 2, 1: 0, 2: 1, 3: 34, 4: 286}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198142394_1198142400 0 Left 1198142394 X:133817593-133817615 CCAAGCCACTTACTAGAAGTCAG 0: 2
1: 0
2: 1
3: 12
4: 106
Right 1198142400 X:133817616-133817638 CAGGACTCCTGGGGAAAGATAGG 0: 2
1: 0
2: 1
3: 34
4: 286
1198142396_1198142400 -5 Left 1198142396 X:133817598-133817620 CCACTTACTAGAAGTCAGCAGGA 0: 2
1: 1
2: 0
3: 9
4: 122
Right 1198142400 X:133817616-133817638 CAGGACTCCTGGGGAAAGATAGG 0: 2
1: 0
2: 1
3: 34
4: 286
1198142393_1198142400 1 Left 1198142393 X:133817592-133817614 CCCAAGCCACTTACTAGAAGTCA 0: 2
1: 0
2: 1
3: 15
4: 125
Right 1198142400 X:133817616-133817638 CAGGACTCCTGGGGAAAGATAGG 0: 2
1: 0
2: 1
3: 34
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198142400 Original CRISPR CAGGACTCCTGGGGAAAGAT AGG Intronic
900474242 1:2868854-2868876 CCTGACTCCTGGGGTCAGATGGG + Intergenic
901904259 1:12394072-12394094 GAGGTCTCCTTGGGAAGGATGGG + Intronic
902513472 1:16978307-16978329 GAGGACAGCTGGGGAAAGACCGG + Exonic
902532196 1:17097722-17097744 AAGGACCCCAGGGGAAAGAAGGG + Intronic
903317074 1:22516387-22516409 CTGGAGTTCTGGGGAAAGGTGGG + Intronic
903664237 1:24996754-24996776 AAGAGCCCCTGGGGAAAGATGGG - Intergenic
904622399 1:31783197-31783219 CAGGAATCCTGGGGAAGCAGAGG + Intergenic
905183502 1:36180233-36180255 AAGGACTTCTGGGGAAAAACAGG - Exonic
905248206 1:36629207-36629229 CTGGTCTGCTGGGGAAGGATGGG + Intergenic
905629275 1:39509941-39509963 CCGGACACCTGGGGAAATGTGGG + Intronic
905668483 1:39776252-39776274 CCGGACACCTGGGGAAATGTGGG - Intronic
905863302 1:41364086-41364108 CAGGCAGCATGGGGAAAGATGGG + Intronic
906236900 1:44217455-44217477 GAGGAGTCAAGGGGAAAGATAGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907597149 1:55730688-55730710 GAGGTCTCCTTGGGAAGGATGGG - Intergenic
909076165 1:71053201-71053223 CAGGACCCCTCGGGAATGAGGGG + Intergenic
910314674 1:85868788-85868810 AAGGTCTCCAGGGAAAAGATGGG - Exonic
910712594 1:90196966-90196988 CAGGACTCCAGGAGAAAGACGGG - Intergenic
910765406 1:90777389-90777411 CAGGCATCCTGGGGATAGAATGG - Intergenic
912517744 1:110226644-110226666 CAGGACCCCTGGCGCAGGATGGG - Intronic
913604494 1:120452462-120452484 CAGGACTTCTTGGGTAAGAACGG + Intergenic
914084047 1:144436742-144436764 CAGGACTTCTTGGGTAAGAACGG - Intronic
914190068 1:145402014-145402036 CAGGACTTCTTGGGTAAGAACGG - Intronic
914277116 1:146135154-146135176 CAGGACTTCTTGGGTAAGAACGG - Intronic
914395683 1:147265469-147265491 CAAGACATCTGGGGAAAGAAGGG + Intronic
914538161 1:148586102-148586124 CAGGACTTCTTGGGTAAGAACGG - Intronic
916303443 1:163301860-163301882 CAGGAACCCTGGGAAAAGCTGGG - Intronic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
917401725 1:174656834-174656856 CAGAACTCCTTGGCAAAGACTGG - Intronic
918284608 1:183039878-183039900 TAGAACCCCTGGGGAAAGGTAGG + Intronic
918479594 1:184964260-184964282 CAGGACTTCTAGCAAAAGATAGG + Intronic
918991991 1:191708594-191708616 CAAGCCTCCTGAGGAAAGAAAGG - Intergenic
920068635 1:203287126-203287148 CTGGAGGCCAGGGGAAAGATCGG - Intergenic
920435206 1:205942820-205942842 CAGGACTAATGGGGACACATGGG + Intronic
920748693 1:208653427-208653449 CTGAACTCCTTGGGAAAGAATGG - Intergenic
920826673 1:209429344-209429366 AATGACTCCTGAGGAAAGGTGGG - Intergenic
921933288 1:220773054-220773076 GATGACTCTTGGGGAAAGAGGGG + Intronic
924343113 1:243053264-243053286 CAGCCCTTCTGGGGAAAGAAGGG - Intergenic
1064841239 10:19594821-19594843 GGGGACTCAAGGGGAAAGATTGG + Intronic
1064873525 10:19966774-19966796 CAGGCCTCCTGGGAAGAGAACGG + Intronic
1067708789 10:48632122-48632144 GAGGACTCGTGGGGAAGGTTGGG - Intronic
1067767371 10:49097176-49097198 AGGGGCTCCTGGTGAAAGATGGG - Intronic
1069809049 10:71145009-71145031 CAGGACTCCTGGGGAAGAGTTGG - Intergenic
1072554356 10:96503559-96503581 CAAGCCTCCTTGGGAAAGATTGG + Intronic
1073065674 10:100757815-100757837 CAGGTCTCCTGAGGAAGGCTGGG + Intronic
1073242681 10:102068458-102068480 GAGGAGTCCTGGGGAAAGGAAGG - Intergenic
1074424935 10:113342426-113342448 CTGGTCTCCTGGGGAAACAGTGG + Intergenic
1074459709 10:113625895-113625917 CTGGAAGCCTGGGGAAAGCTGGG + Intronic
1075237673 10:120745762-120745784 CAGTTTTCCTGGGGAAAGATGGG + Intergenic
1076142462 10:128090759-128090781 CAGGACTCCAGGGAAATGAATGG + Intergenic
1076745360 10:132510164-132510186 CAGGGCTACAGGAGAAAGATGGG - Intergenic
1077026355 11:441720-441742 CTGGACTCCTGGGGCACGCTGGG - Intronic
1077138046 11:1011340-1011362 CAGGACTCCAGGGTAAAGTGTGG + Exonic
1077498882 11:2900010-2900032 TGGGACTCCTGGGGGAGGATGGG - Intronic
1078186608 11:9056970-9056992 CAGGATTTCTGGGAAAAGCTAGG - Intronic
1079014985 11:16861200-16861222 CTGTTCTCCTGGGGAAAGAATGG - Intronic
1079421784 11:20298449-20298471 AAGGACTCTTGGGGGAATATTGG - Intergenic
1081193822 11:40136753-40136775 GAGGAATCCTGGGGAAAAGTGGG + Intronic
1081758278 11:45559889-45559911 CTGCACTCCTGTGGAAACATAGG - Intergenic
1081841326 11:46203550-46203572 CAGGACCCCAGGGGAGGGATGGG + Intergenic
1083268420 11:61557951-61557973 CAGGACTCCAGGGAAGGGATGGG + Intronic
1083601540 11:63951695-63951717 CAGGACTCCTGGGGCGGGGTGGG + Intronic
1083730131 11:64648382-64648404 CACACCTCCTGGGGAAAGAGGGG - Intronic
1084045381 11:66564999-66565021 CAGCCCTCCTGGGGAACGGTGGG + Exonic
1084774291 11:71365132-71365154 CAGGGCTCCTGGGGAAGGACCGG - Intergenic
1084943932 11:72628932-72628954 CAGCACTGCTGGGAAGAGATGGG - Intronic
1085532925 11:77202427-77202449 GATGCCTCCTGGGGAAGGATGGG + Intronic
1087222098 11:95557611-95557633 AAGGAATCATGGAGAAAGATGGG + Intergenic
1088582834 11:111331827-111331849 CACGACTCCTCAGGAGAGATGGG + Intergenic
1088750894 11:112841427-112841449 GAGGAAGCCTGGGGAAATATGGG - Intergenic
1089168209 11:116493980-116494002 CTGGGCTCCTGAGGAAACATGGG - Intergenic
1093616465 12:21231454-21231476 GAGGAGTCCTTGGGAAAAATAGG - Intronic
1095494546 12:42770941-42770963 AAGGACTCCTAGGAAAAGACTGG - Intergenic
1095844586 12:46731362-46731384 GAGGTCTTCTGGGGAAGGATAGG + Intergenic
1095963983 12:47854485-47854507 TAGGAATCCTGGAGAGAGATAGG - Intronic
1096249471 12:50019563-50019585 CAGAAGTCCTGGGACAAGATGGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097445229 12:59662540-59662562 CAGGAGCCCTGGGGAGAGAATGG - Intronic
1097818381 12:64100613-64100635 CAAGACTTATGGGGAAAAATAGG - Intronic
1097843558 12:64344177-64344199 CAGGTCTCCTGGGGGAAGGATGG + Intronic
1098281055 12:68863283-68863305 GAGGAGTCCAGGGGAAAGACAGG + Intronic
1098749647 12:74278080-74278102 CAGGTCTCCTTGGGGAAGAATGG - Intergenic
1099454097 12:82843636-82843658 CAGGAGTTCTGGGTAAAGAAAGG + Intronic
1101229981 12:102730896-102730918 CTGGACTCCTGGGACAAGGTGGG + Intergenic
1101604654 12:106239152-106239174 CAGGACTGCTGTGGACAGTTTGG - Exonic
1102461995 12:113105722-113105744 CAGGACTCTTGGAGAAGGAGAGG + Exonic
1105202491 13:18192176-18192198 CAGAACTACAGGGGAAGGATGGG - Intergenic
1105833165 13:24183766-24183788 CAGCACTCCTGGGGTGAGAAGGG + Intronic
1106135637 13:26971467-26971489 CATGACCCTTGGGGAAAGAAGGG - Intergenic
1106365795 13:29079513-29079535 CAAAACTCTTGGGGAAAAATAGG - Intronic
1109712870 13:66182315-66182337 GAGGTCTCCTTGGGAAGGATTGG + Intergenic
1113395244 13:109941297-109941319 CAGGAGTTCTGAGGAAAGGTGGG - Intergenic
1113886725 13:113664932-113664954 CAGGGCTCCTGGTGAACGATGGG + Intergenic
1114517294 14:23308244-23308266 CTGGTCTCCAGGGGGAAGATGGG + Intronic
1117001384 14:51374874-51374896 GAGGTCTCTTGGGGAAGGATGGG - Intergenic
1117224038 14:53636929-53636951 CAGGACTCTTGGGTCTAGATGGG + Intergenic
1118070397 14:62240715-62240737 GATGAGTCCTGGGGAAAGAAAGG - Intergenic
1118189310 14:63566055-63566077 TAAAACTCCTGGGGAAAGAAGGG + Intergenic
1118723860 14:68612918-68612940 GAGCACTGCTGGGAAAAGATAGG + Intronic
1121444466 14:93969823-93969845 GATGTCACCTGGGGAAAGATGGG - Intronic
1122071538 14:99208478-99208500 CAGGAGACCTCGGGAAAGCTAGG - Intronic
1123411578 15:20065614-20065636 CAGGACACCTGGGAACAGAGAGG - Intergenic
1123520927 15:21072733-21072755 CAGGACACCTGGGAACAGAGAGG - Intergenic
1125898043 15:43319108-43319130 CTGGCTTCCTGGGGAAGGATAGG - Intergenic
1125992738 15:44125805-44125827 GAGGACTACTGTGGCAAGATTGG - Intronic
1128633568 15:69288591-69288613 CAGGGCTCAGGGGGAAAGAAGGG - Intergenic
1128741337 15:70085870-70085892 CAGAAGTCCTGGGGAAAGACAGG - Intronic
1129341718 15:74890553-74890575 CAGTATGCCTGGGGGAAGATGGG + Exonic
1130847417 15:87760136-87760158 TAGGACTCCTAGGGGGAGATCGG - Intergenic
1132102737 15:99036621-99036643 CAGGAATCCTGGGGAAAGAGAGG + Intergenic
1132861602 16:2074470-2074492 CAGGACTCCTTGGGGAACCTGGG + Intronic
1133889190 16:9862621-9862643 CCAGATCCCTGGGGAAAGATAGG + Intronic
1134267594 16:12705237-12705259 AAGGTATCCTGGGGAAGGATGGG - Intronic
1134805264 16:17118809-17118831 AAGGCATCCTGGAGAAAGATGGG - Intronic
1135486180 16:22867081-22867103 TAGTACTGCTGTGGAAAGATCGG + Intronic
1136381177 16:29896712-29896734 AAGGAGTCCTGGGTACAGATGGG - Intronic
1136453069 16:30365262-30365284 GTGGACTGCTGGGGAAAGGTTGG - Intronic
1137294250 16:47074995-47075017 CAGGGCTCCTGCGGAAAGGCAGG + Intergenic
1137441702 16:48503866-48503888 CAGGCATCCTGGGGAAGGAGTGG - Intergenic
1139095034 16:63695093-63695115 AAGGAATTCTGGTGAAAGATAGG + Intergenic
1139661532 16:68424185-68424207 CAGTACTCCTGGCCAAAGAGAGG - Intronic
1141887316 16:86901478-86901500 CAGCACTCCTGGGTCAAGACTGG - Intergenic
1142228230 16:88887702-88887724 CTGGGCTCCTGGGGACAGAGTGG - Intronic
1142600204 17:1050174-1050196 TCAAACTCCTGGGGAAAGATGGG + Exonic
1142752601 17:1997927-1997949 CAGGCCTTCTGGGGAAAGCGTGG + Intronic
1143013335 17:3878437-3878459 CAGGACTTCAGGGGAAAGAAGGG + Intronic
1144672580 17:17141298-17141320 CAGGACACCCAGGGAAAGCTTGG - Intronic
1144837760 17:18166083-18166105 CATTTCTCCTGGGGAAAGAGGGG - Intronic
1148438828 17:47701409-47701431 CATGACTTCTGGGGCAAGCTAGG - Intronic
1148736130 17:49865909-49865931 CAGGAATGCAGGGGAAAGAATGG - Intergenic
1151126390 17:71849767-71849789 TATGACTCCTGGGGAAAGGTAGG + Intergenic
1151515334 17:74590658-74590680 ACGACCTCCTGGGGAAAGATGGG + Exonic
1151808290 17:76420372-76420394 CAGGACCACTGTGGGAAGATAGG - Intronic
1151952411 17:77362420-77362442 CAGGACTGCTGGGGCAAGGGAGG + Intronic
1156149789 18:34227306-34227328 CAGGACCCCTGGGCCCAGATTGG - Intergenic
1157410730 18:47460760-47460782 CAGGACTCCTTGGCAAAAATTGG + Intergenic
1159909498 18:74131864-74131886 CAGGACCCCTGGGGATAACTGGG + Intronic
1160693683 19:472330-472352 CAGTGCTCCTGGGGGGAGATTGG + Intronic
1161613752 19:5258120-5258142 CAGGGCTCCTGTGGGAAGATGGG + Exonic
1162151024 19:8645714-8645736 GTGGACTACTGGGGAAGGATTGG + Intergenic
1162322615 19:9978942-9978964 CAGGACCCCTTGGGAAAGAAGGG - Exonic
1162449279 19:10744741-10744763 CAGGACACCTGTTGCAAGATGGG + Intronic
1162459068 19:10803596-10803618 CAGGAATCCAGAGGAAAGAGTGG - Intronic
1162488617 19:10977751-10977773 CAGTAAACCTGGGGAGAGATGGG + Intronic
1162838077 19:13334660-13334682 CAGGACTTCTGGGAAAAGACTGG + Intronic
1163572950 19:18093582-18093604 CTGGAATCCTGGGGAAAGAGAGG - Intronic
1165158937 19:33804632-33804654 CAGCATTCCTGGAGACAGATGGG - Intronic
1165927011 19:39333057-39333079 CAGGTATCCTGGGGGAAGAAAGG - Exonic
1166528278 19:43526773-43526795 CCCGACTCCCGGGGAAAGAGTGG - Intronic
1167792973 19:51692277-51692299 CAGGCCTCCTGGGGAAGGCATGG - Intergenic
1168487472 19:56776517-56776539 CAGGACTACTGAGGAAACACTGG + Intronic
926136874 2:10342726-10342748 CCGGACTCCTGGGCAAAGAGAGG + Intronic
926382603 2:12305458-12305480 CAGGAATGCTGGGTAAAGGTGGG - Intergenic
926825783 2:16903772-16903794 AGGGTCTCCTTGGGAAAGATGGG + Intergenic
928289000 2:30020974-30020996 CAGGAGTCCAGGGAAAGGATAGG - Intergenic
928418075 2:31113400-31113422 CCTGAATCCTGGGGAAAGCTTGG + Intronic
933511427 2:83246019-83246041 CAGGGCTCCTGGGGGAGGCTCGG + Intergenic
933781881 2:85808146-85808168 GAGGACTCTTGAGGACAGATGGG + Intergenic
936117037 2:109710775-109710797 GAGGAGACCTGGGGAAGGATGGG + Intergenic
936242133 2:110797039-110797061 CAGGGCACCTGGGGCAAGTTGGG - Intronic
936508982 2:113130524-113130546 CAGGTATCCTGGGGAAAGTGAGG + Intronic
936913746 2:117618245-117618267 CTAGACTCCTGAGGAAAGAAGGG - Intergenic
938465515 2:131522324-131522346 AGGGACTTCTGGGGAAAGACTGG + Intergenic
939329627 2:140740496-140740518 GAGGACTTCGGGGGAAGGATGGG + Intronic
939665328 2:144944715-144944737 CAGGTATCCTGGGGATACATGGG + Intergenic
942198447 2:173546423-173546445 GAGGACTCCTAAGGAAAGTTGGG - Intergenic
942210681 2:173666403-173666425 CAGGAAGCCTGGAGAGAGATTGG - Intergenic
944802811 2:203253169-203253191 CAGGACCCGTGGGGACAGAAGGG - Intronic
946056507 2:216907201-216907223 CAGGCCTCATGGGGGTAGATTGG + Intergenic
946255396 2:218438288-218438310 CAGGGCTCCTGGGGATGGGTGGG - Intronic
946758024 2:222965886-222965908 CAGGGCTCCTGGGGCAGGTTTGG - Intergenic
947572080 2:231244248-231244270 CAGAACTCAGGGGGAAAGAAGGG - Intronic
948786809 2:240356976-240356998 CAGGGCTGCTGAGGAAAGAGGGG + Intergenic
1168961691 20:1874461-1874483 CAGCAAAGCTGGGGAAAGATGGG + Intergenic
1172053984 20:32141400-32141422 CAGGACTGCGGGGCAAACATGGG - Intronic
1172111494 20:32547961-32547983 AAGGATTCCTGGGGAGAGAGAGG - Intronic
1173086543 20:39924818-39924840 CTGGAATCCTGGAGAAAGTTTGG + Intergenic
1174294663 20:49537138-49537160 CAGGTCTCCAGGGGAGAGCTTGG - Intronic
1174339097 20:49884831-49884853 CAGGACCCCTGTGCAAAGCTAGG + Intronic
1175183942 20:57167229-57167251 CAGGGCTGCTGGAGAAACATGGG - Intergenic
1175761085 20:61562430-61562452 CAGGACTCCCGGAGAGAGAGAGG + Intronic
1176715459 21:10345834-10345856 CAGAACTACAGGGGAAGGATGGG + Intergenic
1178432109 21:32525965-32525987 CAGGACCCCTGGGGGGAGTTTGG - Intergenic
1179090128 21:38257089-38257111 CAGGTTGCCTTGGGAAAGATAGG - Exonic
1179470470 21:41606743-41606765 AAGGACTCCTGGGAACAGAAAGG - Intergenic
1180034390 21:45236283-45236305 CAGGATTCCTGGGGCTGGATGGG - Intergenic
1180602889 22:17034119-17034141 CAGAACTACAGGGGAAGGATGGG - Intergenic
1181008957 22:20029052-20029074 CAGAACGCCTGGGCAAAGATGGG - Intronic
1181049502 22:20231877-20231899 CTGGACACCTGTGGAAAGACAGG - Intergenic
1182573669 22:31258358-31258380 AAGGACTACTGGGGGAAGTTTGG + Exonic
1182677749 22:32053086-32053108 CTGGACTCCTTGGTAAAGTTTGG + Intronic
1184836028 22:47021529-47021551 CAGGACTCCAGGTGACAGGTGGG - Intronic
1184839526 22:47044312-47044334 AAGGACTCCTGGGGAAAGGCAGG - Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950962613 3:17121347-17121369 CAGGGCACCTGGGGAAAGTCTGG - Intergenic
951735569 3:25859375-25859397 CAGGACTCCATGAGAAAGAAAGG - Intronic
951978022 3:28535605-28535627 GAGGACACATGGGGAAAGTTGGG + Intronic
954699286 3:52443062-52443084 CATGGCTCCTGGGGACAGGTGGG + Intronic
954755738 3:52838679-52838701 CTGCACTCCTGGTGGAAGATGGG + Exonic
955029773 3:55204903-55204925 CAGGAGTCCTGTGGAAGGATAGG - Intergenic
955305145 3:57823001-57823023 CAGCAGTCCTGGGGAGAGAAGGG + Intronic
955846503 3:63168833-63168855 CAGACCTCCTGGGGCTAGATTGG + Intergenic
956327823 3:68072514-68072536 CAGGAGTCCAGGTGACAGATGGG + Intronic
959463772 3:106659437-106659459 GTGGACTCCAGGGGAAAGGTGGG + Intergenic
960816862 3:121682662-121682684 CAGGACATCTGGGCAAAGATGGG + Intronic
961911397 3:130320543-130320565 CAGGACATTTGGGGAAAGAAAGG - Intergenic
962393100 3:134990625-134990647 CAGGACTCCTGGGGATACTGGGG + Intronic
962952509 3:140232433-140232455 GGGGACCCCTGGGGAGAGATGGG - Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966980695 3:185131949-185131971 CAGGACACATGAGGAAAGAGGGG + Intronic
967246832 3:187495866-187495888 GAGGACTCGAGGGGAAGGATGGG + Intergenic
968298418 3:197594856-197594878 CAGGACCCGAGGGGAAAGAAGGG + Intergenic
968476852 4:814686-814708 CCGGACTCCTGGGGAAAACCTGG - Intronic
969363588 4:6681037-6681059 CAGGACTCTGGGGGAAAGCAGGG - Intergenic
969830954 4:9796330-9796352 CAAGACTGCTGGAGAAAGATAGG - Intronic
970560459 4:17276995-17277017 CAGCGCTCCTGGAGAATGATGGG + Intergenic
972324017 4:37998362-37998384 CAGGGCTGCTGGGGAGAGAATGG - Intronic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
972878958 4:43399950-43399972 GGGAACTCCTGGGGAAGGATGGG - Intergenic
973945913 4:55955608-55955630 CAGGTTTCCTGAGGAAAGAATGG + Intronic
977247068 4:94645072-94645094 CAGGACTCAAGGGGAAAGGATGG - Intronic
978181416 4:105800783-105800805 CACTGCTCCTGGGGAAATATAGG + Intronic
978858004 4:113415121-113415143 GAGGACTCATGGGGAAAGGGTGG - Intergenic
980822538 4:138036283-138036305 CTGAACTCCTGAGGCAAGATGGG + Intergenic
981992395 4:150938308-150938330 AAGGATTCCTGGAGAAAAATTGG - Intronic
986157373 5:5190032-5190054 CTGGATTGATGGGGAAAGATGGG + Exonic
987071071 5:14337603-14337625 TAGGACTACTGGGGAAAGAGGGG + Intronic
987726917 5:21715176-21715198 CAGTACTCCTGGGCATAGATGGG + Intergenic
987772702 5:22327200-22327222 GAGGACTCCTGGGAAATGAAAGG + Intronic
991336503 5:65553975-65553997 AAGGACTTCTGGGGTAAGACTGG - Intronic
995264210 5:110139153-110139175 CTGAACTCCTGGGGAAAGGATGG - Intergenic
996284899 5:121778222-121778244 CAGGACTTGGGGGGAAAGGTGGG - Intergenic
996595805 5:125201459-125201481 CAAAACTGCTGGGAAAAGATGGG + Intergenic
997845825 5:137284906-137284928 CATGGCTCCTGGGTAGAGATGGG + Intronic
998054650 5:139064058-139064080 CAGGATTCCTGGGGACTGATAGG - Intronic
998171392 5:139873873-139873895 GACAACTCCTGAGGAAAGATGGG + Intronic
1002334876 5:178470700-178470722 CAGGAATACTGGGGAAATTTCGG - Intronic
1003193469 6:3894144-3894166 CAGGAAACCTGGGGAATGCTGGG - Intergenic
1004352022 6:14898384-14898406 CAGGACTCCTGGTCAAAGAAAGG - Intergenic
1006020121 6:31112782-31112804 CAGGACACCTGGGCCAAGAAGGG - Intergenic
1006899779 6:37492606-37492628 CGGTACTGCTGGGGAAAGAAGGG - Intronic
1007401659 6:41606038-41606060 CAGGACACCTGGGGACAGCCAGG + Intergenic
1007736761 6:43986883-43986905 CAGGGCTCCTGGGAGAAGAAAGG + Intergenic
1007930154 6:45683426-45683448 CAGGATTCCTGAGGAAGGATTGG + Intergenic
1009188964 6:60606524-60606546 CAGGATTCCTGTGGGAAGTTTGG + Intergenic
1010976377 6:82319099-82319121 GGGGAATTCTGGGGAAAGATGGG + Intergenic
1011289594 6:85762866-85762888 GAGGACTCCAGGGGAAAGGGTGG - Intergenic
1012718959 6:102716551-102716573 CAGGACACCTGGGGATAGGAGGG + Intergenic
1014578709 6:123107581-123107603 CAGAACGCCGGGGGAAAGGTGGG + Intergenic
1015894794 6:138006994-138007016 TGGGGCTCCTTGGGAAAGATGGG - Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1017977313 6:159369485-159369507 GAGGTCTCCTGGGAAAGGATGGG + Intergenic
1018480990 6:164190161-164190183 CAGAGCTCATGAGGAAAGATGGG - Intergenic
1022470497 7:30679167-30679189 CTGGACTTCTGGGGACAGGTTGG - Intronic
1024327520 7:48121615-48121637 GAGGACTTGTGGGGAAGGATGGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026826835 7:73587725-73587747 CTGGACTCCCAGGGAAAGAGTGG + Intergenic
1027830437 7:83170289-83170311 CAGACATCCTGAGGAAAGATGGG + Intergenic
1029597124 7:101543891-101543913 CAGGGCTCCTGGGGGAACGTAGG + Intronic
1036396846 8:8377474-8377496 CAGCACTCCTTGGGGAAGCTCGG + Exonic
1038403201 8:27301321-27301343 CATGTCTCCTGGGGACACATGGG + Intronic
1040091401 8:43402288-43402310 CAGGAATATTGGGGAAAGTTTGG - Intergenic
1041924466 8:63221947-63221969 CAGGACTCCTAGAAAAAGAGGGG - Intergenic
1043188398 8:77184901-77184923 GAGGACTCAGGGGGAAAGAGTGG - Intergenic
1043221317 8:77669021-77669043 CAGGACCTTTGGGAAAAGATGGG - Intergenic
1044759955 8:95507400-95507422 AAGAGCTCCTGGGGAAGGATGGG + Intergenic
1045847658 8:106657521-106657543 CAGGACTGCAGGGGAAAGGGTGG - Intronic
1046793160 8:118343178-118343200 GAGGAGAACTGGGGAAAGATTGG - Intronic
1047214222 8:122863728-122863750 CAGTGCTCCTGGGGAGGGATTGG - Intronic
1047611367 8:126523928-126523950 CAGGACTCAGGGGGAAAGGGTGG + Intergenic
1047704450 8:127483839-127483861 CAGGAGTTCTGGGGGATGATGGG - Intergenic
1047861846 8:128975826-128975848 GAGGCCTGCTGGGGAAGGATGGG + Intergenic
1048047330 8:130785276-130785298 CAAGATCCTTGGGGAAAGATGGG - Intronic
1048348387 8:133595588-133595610 GGGGACTCCTGGGGGAAGAGGGG + Intergenic
1049175615 8:141190726-141190748 CATGACTCCGGGGGACACATGGG - Intronic
1049298157 8:141854851-141854873 GAGGTGTCCTGGGGAAAGAACGG + Intergenic
1050735089 9:8752725-8752747 CAGGTCTTCTGGGGAATGATTGG - Intronic
1051074202 9:13210695-13210717 CAGGACTCCAAGGGAATGATGGG + Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056299912 9:85230232-85230254 AGGGACTCCTGGGCACAGATTGG - Intergenic
1059132969 9:111774004-111774026 CAGGACACCTGAGGAAATATAGG + Intronic
1061180293 9:129021556-129021578 CAGGACTTCCGGGGAAAGGAGGG - Intronic
1061198948 9:129125066-129125088 CAGGATGGCTGGGGAAAGAGGGG + Intronic
1061888885 9:133607312-133607334 AAGGGCACCTGGGGAAAGGTGGG - Intergenic
1061914048 9:133739826-133739848 CAGGACTCCTGGGAGAACTTGGG - Exonic
1062124596 9:134853238-134853260 CAGGGCCCCTGGGCAAGGATGGG - Intergenic
1062324370 9:136005148-136005170 CAGGATTCCTGGGCCAAGGTGGG + Intergenic
1062453552 9:136625447-136625469 CAGGACAGCTGGGGAAAAATGGG + Intergenic
1187178875 X:16923931-16923953 CAGGAAGCCTGGGAAAAGGTTGG + Intergenic
1187258759 X:17666012-17666034 GGGGAGTCCTGGGGAAAGAATGG + Intronic
1188937401 X:36193552-36193574 CTGAATTCCTGGGGAAACATAGG + Intergenic
1189361216 X:40353677-40353699 GTGGACTACTGGGGAAAGATGGG - Intergenic
1190242563 X:48668742-48668764 AAGGAGTCCTGGGGAAAGTGAGG + Intergenic
1190461875 X:50684779-50684801 CAGGACACCTGTGAAAAAATTGG + Intronic
1190913641 X:54794052-54794074 CAGGAGCACTGGGGGAAGATAGG + Intronic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191134145 X:57045379-57045401 GAGGACTCCTTGGGGAAGAATGG + Intergenic
1191236917 X:58141538-58141560 CAGAATTCCTGGGGTCAGATAGG - Intergenic
1191740459 X:64432258-64432280 CAGAAGTCCTGGGGAATGAGAGG - Intergenic
1191870447 X:65740815-65740837 CAGGACTCTTGTGAAAAGAGAGG + Exonic
1192267369 X:69547939-69547961 CAGAACTTCTGGAGAAAAATTGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1194513607 X:94823670-94823692 GAGGTCTCCTTGGGAAAGAAGGG + Intergenic
1194604587 X:95963405-95963427 GAGGTCTCCTGGGGAAGGATGGG + Intergenic
1194635732 X:96343142-96343164 CAGAGCTCCTGGGGAAGGGTGGG - Intergenic
1196145502 X:112312448-112312470 CAGGACTCCTGGGAGAACCTTGG + Intergenic
1196288492 X:113911234-113911256 GAGGACTGCTGGGGAAAGGCAGG + Intergenic
1197441799 X:126500544-126500566 AGGGACTCGTGGGGAAGGATGGG - Intergenic
1197475761 X:126923061-126923083 GAGGACTCATGGGGAAAGAGTGG - Intergenic
1197774772 X:130111588-130111610 TAGGACTCCTGCGGGAAGTTGGG + Intergenic
1198142183 X:133815335-133815357 CAGGACTCCTGGGGAAAGATAGG - Intronic
1198142400 X:133817616-133817638 CAGGACTCCTGGGGAAAGATAGG + Intronic
1198431947 X:136576320-136576342 AAGGGCACCTGGGGAAAGAGTGG - Intergenic
1198650632 X:138860303-138860325 CAGGACTCCAGCAGTAAGATAGG + Intronic
1199251054 X:145662116-145662138 CAGCAGTTCTGGGGAAACATTGG + Intergenic
1199498692 X:148484984-148485006 GAGGACTCAGGGGGAAAGAGTGG + Intergenic
1199652314 X:149958613-149958635 CAGGACTCATGGGTAAGGGTGGG - Intergenic
1199982870 X:152930493-152930515 CAGCCCTCCTGGGGACAGCTGGG + Intronic
1200070951 X:153529103-153529125 CAGGTCACCTGGGGAAAGCCTGG - Intronic
1201604555 Y:15770961-15770983 CAGGACTTCCGGGGAAAGGAGGG + Intergenic