ID: 1198145552

View in Genome Browser
Species Human (GRCh38)
Location X:133853038-133853060
Sequence TACTCCATGCTGCCTCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198145552_1198145553 -7 Left 1198145552 X:133853038-133853060 CCAGTGAGAGGCAGCATGGAGTA 0: 1
1: 0
2: 1
3: 19
4: 203
Right 1198145553 X:133853054-133853076 TGGAGTATTAGAAAGACACAAGG 0: 1
1: 0
2: 0
3: 38
4: 362
1198145552_1198145554 4 Left 1198145552 X:133853038-133853060 CCAGTGAGAGGCAGCATGGAGTA 0: 1
1: 0
2: 1
3: 19
4: 203
Right 1198145554 X:133853065-133853087 AAAGACACAAGGAAAAATACAGG 0: 1
1: 2
2: 4
3: 78
4: 985

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198145552 Original CRISPR TACTCCATGCTGCCTCTCAC TGG (reversed) Intronic
902301272 1:15504525-15504547 TTCTCCAGCCTGCCCCTCACAGG - Intronic
902652807 1:17847498-17847520 TCCTCCTTGCTGCCTCTGCCTGG + Intergenic
902694881 1:18133545-18133567 TGCTCCATGCTGCCGCTTTCAGG + Intronic
905165770 1:36082302-36082324 TGCTCCACACTGCCTCTCATGGG - Intergenic
905868354 1:41388544-41388566 TTCACCATGCTGCCACTCAACGG - Intergenic
906693783 1:47810705-47810727 TACTCCCTGCTGCCTCACTATGG - Intronic
907311554 1:53541775-53541797 AACTCCGTCCTGCCTCTCACAGG - Intronic
908317269 1:62945318-62945340 TACACCATGGTGCATCTCAAAGG + Intergenic
909591077 1:77350291-77350313 AACTCCTTCCTGCCTCTCAAGGG - Intronic
910513831 1:88036628-88036650 TCCTCAATTCTGCTTCTCACTGG + Intergenic
912689046 1:111790122-111790144 TAGGCCATGCTGCCTCCCTCTGG - Intronic
913134295 1:115873090-115873112 TTCTCCATGGTGGCTCTCATTGG - Intergenic
913340933 1:117757616-117757638 TGGCCCATGCTGCCCCTCACAGG + Intergenic
913708027 1:121447910-121447932 AACTACTTGCTTCCTCTCACAGG - Intergenic
916149818 1:161776280-161776302 TACTCCATTCCCCCTCCCACTGG + Intronic
917231602 1:172843619-172843641 TACCCCTTGGTGACTCTCACAGG + Intergenic
918258336 1:182770598-182770620 TGCTCCATGCTGCCTTTCCAAGG - Intergenic
919592094 1:199517126-199517148 TATTCCACACTGCCTCTTACAGG - Intergenic
921262067 1:213393480-213393502 TCCTGCATGCTGCTGCTCACAGG + Intergenic
922292929 1:224223796-224223818 AACTCCATGCTGCCCTTCCCGGG - Intergenic
922358893 1:224802808-224802830 TGCCCCATGCTCCCTCCCACTGG - Intergenic
924370358 1:243341346-243341368 TACTACATGCAGCCCCTCAGTGG + Intronic
1063876381 10:10483716-10483738 TCCTCCTTTCAGCCTCTCACTGG - Intergenic
1067199991 10:44160233-44160255 TACTCAAGCCTCCCTCTCACTGG - Intergenic
1067750029 10:48965369-48965391 GACTCCATGCTGCTCCTGACAGG + Intronic
1068006681 10:51399351-51399373 TACAGCATGCTGCCTGTCATTGG + Intronic
1069992231 10:72322821-72322843 TCCTCCATTCTCCATCTCACAGG + Intergenic
1072318734 10:94228248-94228270 CATACCATGCTGCCTCCCACAGG - Intronic
1072697090 10:97611795-97611817 TCCTCCAGGCAGCCTTTCACAGG + Exonic
1074098701 10:110336083-110336105 TTGTCCATCCTGGCTCTCACAGG + Intergenic
1075906063 10:126083118-126083140 TACTCCATGCTGCCTGGAGCGGG + Intronic
1077461758 11:2714312-2714334 TAGTGCCTGCTGCCTCTCACGGG - Intronic
1079359704 11:19760211-19760233 TTCTCCAGCCTGCCTCTCAGAGG - Intronic
1079375739 11:19890264-19890286 TACACCATGCTGCCTCACAGAGG + Intronic
1080035656 11:27707577-27707599 AACTTCTTGGTGCCTCTCACTGG - Intronic
1082034021 11:47629525-47629547 TATTCCATGCTGCCTCACCTAGG - Intronic
1084449572 11:69228007-69228029 TGCACCCTGCTGCCTCTGACAGG - Intergenic
1084456193 11:69269428-69269450 GACCACATGCTGCCTCTGACTGG - Intergenic
1084501597 11:69538688-69538710 TAGTCAATGCTGTCTCTCTCCGG + Intergenic
1085411373 11:76292602-76292624 TTCTGCATGCTGCCTCTAAGCGG + Intergenic
1088404259 11:109455426-109455448 TATTCCATGCCTCCTTTCACTGG + Intergenic
1088722216 11:112604122-112604144 TACTACATGGTGCCTTTCACAGG + Intergenic
1089148930 11:116349922-116349944 TACTCCCTGCTGCAGCTCATGGG + Intergenic
1089680464 11:120116419-120116441 GACCGCATGCAGCCTCTCACTGG - Intronic
1090236872 11:125154740-125154762 CACTCCATCCTGGCTGTCACAGG - Intergenic
1090844142 11:130516953-130516975 TCCTCTATGATGCCTCGCACAGG + Intergenic
1091696395 12:2630897-2630919 GGCTCCACGCTGGCTCTCACTGG - Intronic
1091918357 12:4285182-4285204 TCCTCCATGCTGCCTGGAACAGG + Intronic
1094367819 12:29702689-29702711 TACTCAAGGCTGCCTCCCAATGG - Intronic
1094460509 12:30693199-30693221 TCCTCTATGCTGCCTCTAATGGG + Intronic
1095045953 12:37505769-37505791 TACTCCATGCCGTCTCGCACTGG + Intergenic
1095938574 12:47710955-47710977 CACTTCACGCTGCCTCTCCCTGG + Intronic
1097195975 12:57242687-57242709 CACCCCAGCCTGCCTCTCACTGG + Intergenic
1099043580 12:77686951-77686973 GACTCAATGCTGCCTCTCGGTGG + Intergenic
1099359409 12:81681144-81681166 GACTGCATGCTGCTTCACACTGG + Intronic
1102815641 12:115863542-115863564 GACTACATGCTGTCTCTCATTGG - Intergenic
1105733732 13:23246409-23246431 TATTCCAGGCTGCCTTTCAAAGG + Intronic
1105885277 13:24636758-24636780 CACTCCATGCTGCCTCTTCATGG + Intergenic
1113135940 13:107089824-107089846 AAATCCATGGTGCCTGTCACAGG - Intergenic
1113576196 13:111396801-111396823 TATTCCCAGGTGCCTCTCACTGG - Intergenic
1113890579 13:113733161-113733183 TCCTCCCTGCCGACTCTCACAGG - Intronic
1114544125 14:23486058-23486080 TACTCACTGCTGACTCTTACAGG + Intronic
1114614356 14:24060348-24060370 CACTGCATGGTGCCTATCACTGG + Intronic
1118356258 14:65016426-65016448 GAGCCCATGCTGCCTCTCAGTGG - Intronic
1118554665 14:67003742-67003764 TACTTCTTGCTGCCTCTTCCTGG + Intronic
1119236336 14:73022825-73022847 TACTCCCAGATGCCCCTCACTGG + Intronic
1119644483 14:76338510-76338532 AACTCCAGGCTGCCTGTCCCTGG + Intronic
1122309044 14:100783190-100783212 TCCCCGATCCTGCCTCTCACGGG - Intergenic
1122438771 14:101716219-101716241 CTCTCCATGCTGCCCCCCACCGG - Intergenic
1124003301 15:25777252-25777274 TGCTCCATGCACCCTCTCAAAGG + Intronic
1124515099 15:30361170-30361192 TCCTCCCTGCTGCCTGCCACTGG + Intergenic
1124727823 15:32169557-32169579 TCCTCCCTGCTGCCTGCCACTGG - Intronic
1126065807 15:44825374-44825396 TACAACATGCTGCCTCTCATAGG - Intergenic
1126094027 15:45075192-45075214 TACAACATGCTGCCTCTCATAGG + Exonic
1127383307 15:58448018-58448040 TACTCCAAGCTGCCTCCCCTAGG + Intronic
1127733357 15:61819863-61819885 TCCTCCCTGCTCCCTCTCCCCGG - Intergenic
1127823976 15:62686896-62686918 CACTCCACGCTGGCTCTCCCAGG - Intronic
1128553605 15:68615035-68615057 TTCTCAATGCTGCCTCTGAGAGG + Intronic
1130453189 15:84078289-84078311 TACTGCATGCTGTCACTCATAGG + Intergenic
1132878476 16:2150562-2150584 TCCTCCATCCTCCCTCTAACTGG - Intronic
1134316559 16:13124193-13124215 TCCTGCATGCTGCCTCTGTCAGG - Intronic
1134466885 16:14486811-14486833 TGCTACATGCTGCTTCTGACAGG - Intronic
1135649417 16:24192930-24192952 TTCTCCATGCTACCTCCCTCTGG - Intronic
1136145061 16:28311743-28311765 TACCCCACGCTGCCTCTCTATGG - Intronic
1137675907 16:50303844-50303866 TCCTCCTGGCTGCTTCTCACAGG + Intronic
1138597291 16:58035821-58035843 TTCTCCATGCTGCCCCTCCTTGG + Intronic
1140235043 16:73151441-73151463 TCCTCCAACCTGCCTCTGACTGG - Intergenic
1141277509 16:82601987-82602009 TTCTCCAGGCAGCCTCTCATGGG + Intergenic
1142213914 16:88821697-88821719 TGCTCTCTGCTGCCTCCCACCGG + Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1142865369 17:2787641-2787663 CACTGCAAGCTGCCTCTCCCAGG + Intronic
1143088262 17:4433226-4433248 GACACCCTCCTGCCTCTCACAGG + Intergenic
1144588556 17:16504296-16504318 TCCTCATTGCTGCCTGTCACTGG + Intergenic
1144671431 17:17134739-17134761 ACCCCCATGCTGCCCCTCACTGG + Intronic
1146539094 17:33679499-33679521 TATTCCCTGCTGCATCTCCCAGG - Intronic
1147302005 17:39537047-39537069 TTCTTCATGCTGCCTCCCTCAGG - Intronic
1150903719 17:69314543-69314565 TACTCCAAGCTGTCTCTCTTAGG + Intronic
1151418238 17:73980796-73980818 TACACAATGCTGCCTCTGCCCGG - Intergenic
1152737313 17:82003929-82003951 AACTCCACACTCCCTCTCACCGG + Intronic
1153140819 18:1970784-1970806 TACTCCCTGCTGCATGTAACTGG - Intergenic
1153964351 18:10166564-10166586 TGCTCCATCCTGCCCCTCTCAGG - Intergenic
1155177428 18:23313049-23313071 CACTGCATGCTCCCTCTCCCGGG - Intronic
1155792129 18:29986151-29986173 TACTCCATGTTTTCACTCACAGG + Intergenic
1157119501 18:44895625-44895647 TACCCCATGCTGCCTCCCAGTGG + Intronic
1157548161 18:48562405-48562427 TGGGCCATGCTGCCTCTCACTGG + Intronic
1157960089 18:52143839-52143861 CATTCCATGCTGCCTTACACAGG + Intergenic
1157990912 18:52495161-52495183 AACTCCATTCTGCTTCTCAGAGG + Intronic
1164829582 19:31310233-31310255 TCCTCCAAGCTGCCTCTCAATGG + Intronic
925888394 2:8412955-8412977 TTCTCCAGCCTGCCTCTCAAGGG - Intergenic
926056940 2:9779224-9779246 TTCTCTTGGCTGCCTCTCACTGG + Intergenic
926329292 2:11811316-11811338 GTCTCCATGGTGCCCCTCACAGG - Intronic
927361377 2:22238105-22238127 TACCCCATACTACCTCTTACTGG - Intergenic
929901901 2:46012175-46012197 TTTTCCATGGTGCCTATCACAGG + Intronic
931860229 2:66346745-66346767 CCCTCTTTGCTGCCTCTCACAGG - Intergenic
932398990 2:71466668-71466690 TCCTCCCTGCAGCCTCTCCCAGG + Intronic
932759773 2:74431575-74431597 CTGTCCATGCTGCCTCTCAGAGG + Intronic
934557200 2:95293766-95293788 GACTCCATGCTGTCTCTCACAGG - Intergenic
936594618 2:113836024-113836046 TACTGCAAGCTCCGTCTCACAGG + Intergenic
938062028 2:128261871-128261893 TGCTCCCTGCTGCCTTTCACTGG - Intronic
942351421 2:175057265-175057287 GACTCCATGCCGCCTCTAGCAGG + Intergenic
945811948 2:214559472-214559494 TGCTGCCTGATGCCTCTCACTGG + Intronic
946130255 2:217601137-217601159 TACCCCATGCTGCCCATCAGAGG + Intronic
947319024 2:228896326-228896348 TTCTCCATGTTGCCTCTTAATGG + Intronic
948123016 2:235544696-235544718 AAACCAATGCTGCCTCTCACAGG + Intronic
1169350467 20:4864085-4864107 TACTCTGTGCTGCCTCTTGCAGG + Intronic
1169591619 20:7148968-7148990 TACTCCATTCTTTCTCACACAGG - Intergenic
1170027682 20:11907872-11907894 CAAGCCATGCTTCCTCTCACTGG + Intronic
1171446209 20:25206357-25206379 TCCCACATGCTGCCTCGCACTGG + Intronic
1171458810 20:25287023-25287045 GACTCCCTGCTGCCTCACCCAGG + Intronic
1178431345 21:32521065-32521087 TGCTGGATGCTGCCTCTCACGGG - Intergenic
1179460236 21:41529558-41529580 CCCCCCATTCTGCCTCTCACAGG - Intronic
1179482485 21:41687093-41687115 TATTCCATTCTGCCTCTCTCAGG + Intergenic
1180105971 21:45618337-45618359 TACTTCCTGCTGCCTGTCACTGG - Intergenic
1183455620 22:37921660-37921682 TACTGGATGCAGCCACTCACTGG + Intronic
950172100 3:10845896-10845918 TCCTCCTTGCTGCCTCTTCCAGG + Intronic
954709182 3:52496506-52496528 TTCTCCCTGCTGCCTCTCTGAGG - Intronic
955618900 3:60839970-60839992 ACCTTCATGCTGCCTCTCAGAGG + Intronic
958484993 3:94694052-94694074 TACTCACTGCTGCCTTTCAGGGG + Intergenic
958871519 3:99564420-99564442 TATTCCATCCTGTGTCTCACAGG + Intergenic
960369148 3:116811898-116811920 TAGTCCAGGCTGACTGTCACAGG + Intronic
961366791 3:126405203-126405225 TACTGTATGCTGCCACTCACAGG - Intronic
961431619 3:126888065-126888087 TCCTGCCTGCTGCCTCTCTCTGG + Intronic
961460661 3:127048104-127048126 TTCTCCATGCTGGTTCTGACTGG + Intergenic
961633427 3:128317990-128318012 AACTCCATCCTGCCTCTGCCTGG - Intronic
962736518 3:138329953-138329975 GACTCCCTCCTGCCTCTCCCTGG - Intergenic
963234355 3:142941873-142941895 TGCTCCTTGCTGCCTCTCTGAGG + Intergenic
964194495 3:154046887-154046909 TACTCCCTCTTGCCTCTCATAGG - Intergenic
967453804 3:189657368-189657390 TACCCCATTCTGCCTTCCACTGG - Intronic
967640842 3:191861358-191861380 AGCTCCATCCTGCCCCTCACAGG - Intergenic
967807009 3:193723496-193723518 TCCTCCATGCTATCTCTCTCTGG - Intergenic
967953138 3:194856341-194856363 TACCCGGTGCTGCCTCTCTCAGG + Intergenic
971763674 4:30802508-30802530 CACTCCTTCCTGCCTCTGACAGG - Intronic
972211183 4:36840230-36840252 TAATCCATGCTGCCTCTAGAAGG + Intergenic
975891638 4:79036132-79036154 GCTTCCATGCTGCCTCTCAGTGG + Intergenic
976370583 4:84284082-84284104 TGCAGCATGCTGCCTCTCTCTGG - Intergenic
977112109 4:92970875-92970897 TACTACATGTTGCTTATCACTGG + Intronic
978189782 4:105897587-105897609 TTCTCAAGGCTGCCACTCACAGG - Intronic
978775793 4:112505865-112505887 TACACCATGCAGTGTCTCACTGG - Intergenic
982104112 4:151997023-151997045 TACTTCAGGCAGTCTCTCACTGG - Intergenic
982610801 4:157572381-157572403 TACATCATGCTACCTCTCAATGG - Intergenic
983339068 4:166434720-166434742 TCCTCCATCCTGCCCCTCATGGG + Intergenic
985968788 5:3358347-3358369 GACTCCATGCTTCCTGGCACTGG + Intergenic
986183350 5:5414734-5414756 TATTTCATACTGCCTCTCATGGG - Intergenic
987574840 5:19711740-19711762 TTCTCCATGCTGTTTCTCAGAGG - Intronic
989368672 5:40682127-40682149 TACCCCTTGCTGCCTGACACTGG + Intronic
989970072 5:50512792-50512814 AACTTCTTGCTTCCTCTCACGGG + Intergenic
991943000 5:71872882-71872904 TATTCCATGGTACCTCACACAGG - Intergenic
992199892 5:74372595-74372617 TACTCCATGCTTTCTCTCCCGGG + Intergenic
992752920 5:79877547-79877569 TACTCCCTGCTGCATCTCTAGGG - Intergenic
999331725 5:150678026-150678048 CACCCCATGCTGGCCCTCACTGG - Exonic
1002076290 5:176710453-176710475 TATTCCAGGCTGCAGCTCACTGG + Intergenic
1004219234 6:13731243-13731265 TTTTCCCTGCTGCCTCACACAGG - Intergenic
1004566803 6:16805548-16805570 CACATCATGCTGCCTCTCTCTGG + Intergenic
1007115249 6:39338860-39338882 GACTCCATGCTCCCTACCACCGG - Intronic
1008857772 6:56112517-56112539 CACTCCATGCTGCCTCTGCTGGG - Intronic
1009746108 6:67818264-67818286 TACACTATGCTGCCTCTCAAGGG - Intergenic
1010378448 6:75201936-75201958 TGCTCCATCCTGCCTCCCTCAGG - Intronic
1013455966 6:110330028-110330050 TACTCTAGGCTGCCTGGCACCGG + Intronic
1013764458 6:113558519-113558541 TAGTCCCTGCAGCCTCTTACTGG - Intergenic
1015512544 6:134052679-134052701 TATTCCAAGCAGCCTATCACAGG + Intergenic
1016976113 6:149810017-149810039 TATTCCTTCCTTCCTCTCACTGG + Intronic
1020769312 7:12368456-12368478 CACTCACTGCTCCCTCTCACCGG - Intronic
1026463215 7:70632579-70632601 AACTCCCTGCTGCCACTCTCTGG + Intronic
1028687792 7:93611835-93611857 TACTCCTTGCTGTCTCTCTTGGG + Intronic
1031028160 7:116704255-116704277 TAGTCCATGCTGTCTCCCAACGG - Intronic
1033890205 7:146003135-146003157 TCCTCCATCCTGCCTATTACAGG + Intergenic
1035314217 7:157988183-157988205 AACACCATGCTGTCTCTCCCCGG + Intronic
1038595620 8:28883088-28883110 AACTCCAGGCTTCCTCTCACTGG + Intronic
1042359887 8:67870373-67870395 TAATCCATGCTTTATCTCACTGG - Intergenic
1042681684 8:71392572-71392594 TACTCCATCTTGGCTGTCACTGG + Intergenic
1043481378 8:80656120-80656142 TCCTCCATGCTTGCTCTCCCTGG + Intronic
1044488397 8:92781809-92781831 TACTAAATGCTGCATTTCACAGG + Intergenic
1045209961 8:100086940-100086962 TACTTCATGCTGACTCTCATGGG + Intronic
1045868054 8:106891964-106891986 TTCTCCATGCTGCCTATTGCAGG - Intergenic
1047756269 8:127921158-127921180 TGGTTCATGCAGCCTCTCACAGG - Intergenic
1047762820 8:127966915-127966937 GACTCCATGCCCCCTGTCACGGG + Intergenic
1047921451 8:129638870-129638892 TACTCCATATTACCTCTAACAGG - Intergenic
1051529144 9:18080070-18080092 TCCTCCATTCTGCCTCTGCCAGG - Intergenic
1053614544 9:39749965-39749987 TTGTCAATGCTGCCTCTTACAGG + Intergenic
1053900179 9:42788013-42788035 TTGTCAATGCTGCCTCTTACAGG - Intergenic
1054238974 9:62592427-62592449 TTGTCAATGCTGCCTCTTACAGG - Intergenic
1054261462 9:62869583-62869605 TTGTCAATGCTGCCTCTTACAGG + Intergenic
1054553103 9:66626949-66626971 TTGTCAATGCTGCCTCTTACAGG - Intergenic
1056137160 9:83641753-83641775 AACTCCATGCTGCCTGTGGCTGG - Intronic
1056469284 9:86889503-86889525 TACTCCTTCCTTCCTCTCAGAGG - Intergenic
1057941638 9:99290111-99290133 TACACCATTCTGCCTTGCACTGG + Intergenic
1058121302 9:101142267-101142289 TATACCATTCTGCCTCTCTCTGG + Intronic
1059236229 9:112762856-112762878 TGCTCCATGCTGGCTCCCAGCGG - Intronic
1059459002 9:114417990-114418012 TACTCCACTCTGTCTCTCCCAGG - Intronic
1059466394 9:114471454-114471476 TGCACCACACTGCCTCTCACCGG + Intronic
1059503367 9:114775933-114775955 TATTCTATGCTGCATCACACAGG + Intergenic
1185796813 X:2972527-2972549 TACCCCAAGCTGCCTCACCCTGG + Intergenic
1185855729 X:3533219-3533241 TACTCTATGCTGCATCTCCTTGG + Intergenic
1188096933 X:26034833-26034855 TACTGCATGCTCTCACTCACAGG + Intergenic
1189757460 X:44285476-44285498 TATTCCAGGCTGCCTTTCAAAGG + Intronic
1190688126 X:52892094-52892116 TACTCCATGTGGCCTCCCAGTGG - Intronic
1190697856 X:52963698-52963720 TACTCCATGTGGCCTCCCAGTGG + Intronic
1192181488 X:68918460-68918482 CACTCCAGGCTTCCTCTCATAGG + Intergenic
1194065511 X:89255867-89255889 TCCTCCATCCTCCCTCTGACAGG + Intergenic
1194141996 X:90219370-90219392 CACGCCATACTACCTCTCACAGG - Intergenic
1195510250 X:105707553-105707575 TCCTCCATACTGCATTTCACAGG - Intronic
1198145552 X:133853038-133853060 TACTCCATGCTGCCTCTCACTGG - Intronic
1200487756 Y:3788483-3788505 CACGCCATACTACCTCTCACAGG - Intergenic
1200719680 Y:6589962-6589984 TCCTCCATCCTCCCTCTGACAGG + Intergenic