ID: 1198146171

View in Genome Browser
Species Human (GRCh38)
Location X:133859517-133859539
Sequence GTGTGGGTAGGGAGAGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 958
Summary {0: 1, 1: 1, 2: 6, 3: 84, 4: 866}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198146163_1198146171 -2 Left 1198146163 X:133859496-133859518 CCCAGGGCCCACTTTAGCTGTGT 0: 1
1: 0
2: 1
3: 13
4: 127
Right 1198146171 X:133859517-133859539 GTGTGGGTAGGGAGAGATGAAGG 0: 1
1: 1
2: 6
3: 84
4: 866
1198146158_1198146171 23 Left 1198146158 X:133859471-133859493 CCTAGGAAATCTGCTCTTCAGGG 0: 1
1: 0
2: 1
3: 18
4: 175
Right 1198146171 X:133859517-133859539 GTGTGGGTAGGGAGAGATGAAGG 0: 1
1: 1
2: 6
3: 84
4: 866
1198146162_1198146171 -1 Left 1198146162 X:133859495-133859517 CCCCAGGGCCCACTTTAGCTGTG 0: 1
1: 0
2: 3
3: 17
4: 181
Right 1198146171 X:133859517-133859539 GTGTGGGTAGGGAGAGATGAAGG 0: 1
1: 1
2: 6
3: 84
4: 866
1198146164_1198146171 -3 Left 1198146164 X:133859497-133859519 CCAGGGCCCACTTTAGCTGTGTG 0: 1
1: 0
2: 0
3: 11
4: 137
Right 1198146171 X:133859517-133859539 GTGTGGGTAGGGAGAGATGAAGG 0: 1
1: 1
2: 6
3: 84
4: 866
1198146167_1198146171 -9 Left 1198146167 X:133859503-133859525 CCCACTTTAGCTGTGTGTGGGTA 0: 1
1: 0
2: 0
3: 5
4: 128
Right 1198146171 X:133859517-133859539 GTGTGGGTAGGGAGAGATGAAGG 0: 1
1: 1
2: 6
3: 84
4: 866
1198146168_1198146171 -10 Left 1198146168 X:133859504-133859526 CCACTTTAGCTGTGTGTGGGTAG 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1198146171 X:133859517-133859539 GTGTGGGTAGGGAGAGATGAAGG 0: 1
1: 1
2: 6
3: 84
4: 866

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198146171 Original CRISPR GTGTGGGTAGGGAGAGATGA AGG Intronic
900037385 1:427478-427500 GTGGGGGTTGGGAGAGGTGGGGG + Intergenic
900059015 1:663219-663241 GTGGGGGTTGGGAGAGGTGGGGG + Intergenic
900427551 1:2587425-2587447 GGGGAGGCAGGGAGAGATGAGGG - Intronic
900501207 1:3005531-3005553 GGGTGGGGAGGGAGCTATGAGGG + Intergenic
900746851 1:4366400-4366422 GTGTGAGTAGGGACAGAGAATGG + Intergenic
900919752 1:5662729-5662751 GTCTGGGTGGGGTGAAATGATGG - Intergenic
901450065 1:9330651-9330673 GTTTGGGAAGGGAGAGAAAAAGG - Intronic
901791435 1:11655265-11655287 GTGGGGGTGGGGAGATAGGAAGG + Intronic
901877653 1:12175892-12175914 GTGTGGGGAGAGAGATATGGAGG + Intronic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
901911797 1:12464709-12464731 GTGGGGGTGGGGAGAGAAGAGGG + Intronic
902528264 1:17073610-17073632 GAGTGGGGAGGGAGAGAGGAGGG + Intronic
902577222 1:17386052-17386074 GGGTGGGTAGGGAGAGTTTGAGG + Intronic
902626935 1:17682291-17682313 GTGTGGAATGGGAGAGACGAGGG - Intronic
902666661 1:17944073-17944095 GTGTGGGTTGAGGGAGAGGAAGG + Intergenic
902801136 1:18830995-18831017 GTGTGGGGTGGGTGAGAGGAGGG - Intergenic
903034610 1:20485866-20485888 GGGAGGGGAGGGAGAGAGGAGGG + Exonic
903273895 1:22208824-22208846 GTGTGGGCAGGGAGCGACGGTGG + Intergenic
903560720 1:24225021-24225043 GTGGGGGAAGGGAGATAGGAGGG - Intergenic
903684470 1:25120675-25120697 GTTGGGGCAGGGGGAGATGAGGG - Intergenic
903739969 1:25553025-25553047 GGGTGGGTGGGGAGAGGAGAAGG - Intronic
903852326 1:26315580-26315602 GGGCGGGGAGGGAGAGAAGAGGG - Intronic
904326113 1:29727896-29727918 GTGAGGGGAGGGAGAGCTGTAGG + Intergenic
904354671 1:29931141-29931163 GTGGGGTGAGGGAGAGAAGATGG - Intergenic
905380003 1:37555155-37555177 CTGTGCTTTGGGAGAGATGATGG - Intergenic
905547371 1:38810514-38810536 ATTTGGGTGGGCAGAGATGAGGG - Intergenic
905689306 1:39931102-39931124 GTGTTGGCAGAGAGAGCTGATGG - Intergenic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
906359352 1:45139436-45139458 GAGAGGGGAGGGAGAGAGGAGGG - Intronic
906567395 1:46810944-46810966 GTGGGGGTGAGGAGAGAGGATGG + Exonic
906652043 1:47519755-47519777 GTGTGGGCAGGGAGGGAGGGTGG + Intergenic
907423666 1:54364745-54364767 GTCTGGGCAGGGAGAGAGGCAGG - Intronic
908210104 1:61891468-61891490 GTGTGAGTTGGGAGAGAAAAGGG + Intronic
908796834 1:67838520-67838542 GTGTGGGAAGGGTGTGATGAGGG - Intergenic
909783488 1:79580208-79580230 CTGAGGGTAGAGAGAAATGAGGG - Intergenic
910056206 1:83035598-83035620 ATGTGGGTAGGGTCAGATAAGGG - Intergenic
910158059 1:84242768-84242790 GTTTGGGGAGGGAGAGTGGAGGG - Intergenic
911144446 1:94539225-94539247 GTGGGGGGAGAGAAAGATGAAGG - Intronic
911298519 1:96146915-96146937 CTGTGCGTTGGGAGATATGATGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
913511067 1:119563022-119563044 GAGCAGGTAGGGAGAGATAATGG - Intergenic
913528295 1:119713858-119713880 GTGGGGATAGGGAGGGATGAGGG + Intronic
913583519 1:120250310-120250332 ATGTGGATAGGGAGAGCTGGAGG - Intergenic
913624657 1:120648009-120648031 ATGTGGATAGGGAGAGCTGGAGG + Intergenic
914417769 1:147499717-147499739 GTGTTTGGAGGGAGAGGTGAGGG + Intergenic
914565506 1:148862147-148862169 ATGTGGATAGGGAGAGCTGGAGG - Intronic
914607319 1:149268102-149268124 ATGTGGATAGGGAGAGCTGGAGG + Intergenic
914676182 1:149909124-149909146 GTGTGGGCTGGGAGAGAGGTGGG - Intronic
915235064 1:154474392-154474414 GTGTGGCTAGGTATAGATGGAGG - Intronic
915327067 1:155086093-155086115 GTGCGGGTGGGGAGAGAGGAGGG - Intronic
915347718 1:155206473-155206495 GTGGGGGTAGGGGGTGATGTGGG - Intronic
915476673 1:156156597-156156619 GTGTGGGCTGGGAGTGAAGAGGG + Intronic
915479150 1:156173357-156173379 GTCTGTGAAGGGAGAGAGGAAGG + Intronic
916017943 1:160766900-160766922 ATGAGGACAGGGAGAGATGAAGG + Intergenic
916060189 1:161092983-161093005 TTGTGCTTAGGGAGAGAGGAGGG + Intergenic
916613980 1:166421073-166421095 GTGGGAGTAGGGATAGATGAAGG + Intergenic
916772276 1:167922511-167922533 GTGTAGGTAGGGAGAGAAGAAGG + Intronic
916985296 1:170184807-170184829 GGCTGGGGAGGGAGTGATGAAGG - Intergenic
917572403 1:176281891-176281913 GGGAGGGGAGGGAGAGAGGAAGG - Intergenic
917808432 1:178635057-178635079 GGGTGGCTTGGGAGAGAAGACGG - Intergenic
918147739 1:181772342-181772364 GTGGGGGTGTGGAGAGAGGAGGG - Intronic
918576197 1:186063405-186063427 GAGTGGGGAGGGAGAAAGGAAGG + Intronic
919043257 1:192419965-192419987 ATGTAGGTAGGGAGATATGAAGG + Intergenic
919045622 1:192448133-192448155 CTGGGGGTAGGGAGTGATAAAGG - Intergenic
919990075 1:202703414-202703436 AAGTGGGGAGGGAGAGATGAAGG + Intronic
920124420 1:203682261-203682283 GTGTGGGTTGTGGGAGAGGAAGG + Intronic
920215340 1:204358734-204358756 GGGTGGGGAGGGAGAGCTGCAGG - Intronic
920632714 1:207668508-207668530 GTTGGGGTAGGGAGAGACAATGG + Intronic
920654608 1:207866518-207866540 AGGTGGGCAGGGTGAGATGATGG - Intergenic
920678518 1:208055405-208055427 CTGAGGATGGGGAGAGATGAAGG + Intronic
920839548 1:209542730-209542752 GTGGTGGGAGGGAGAGAGGAGGG - Intergenic
920855204 1:209656231-209656253 GTGAGGGTGGGGAGAGGAGAAGG - Intergenic
921421904 1:214958212-214958234 GTGAGGTTAGAGTGAGATGATGG - Intergenic
922580672 1:226695600-226695622 GTGTGAGAAGAGAGAGAGGATGG - Intronic
923225636 1:231936440-231936462 GTGTGGGTAGAGAGAGTGCAGGG - Intronic
923362653 1:233226800-233226822 GTGTGGGCATGGGGAGAGGAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923383716 1:233446626-233446648 CTGTAGGAAGGGACAGATGATGG + Intergenic
923684762 1:236146372-236146394 GGGTGGGGAGGAAGAGAGGATGG + Intronic
923757188 1:236802467-236802489 GAGTGGGAAGGGCTAGATGAGGG + Intronic
923987090 1:239393494-239393516 TTGTGTGAAGGGAGAGGTGATGG + Intronic
1062788411 10:284592-284614 GAGTGGCAAGGGGGAGATGACGG + Intronic
1063424550 10:5941210-5941232 GATTGGGACGGGAGAGATGAAGG + Intronic
1063601677 10:7487345-7487367 GTGTGTGTGGTGAGAGAAGAAGG - Intergenic
1064453695 10:15467215-15467237 GTGTGGCAGGGGAGAGAAGAGGG + Intergenic
1065169118 10:23010227-23010249 GGATGGGAAGGGAGAGAGGAGGG - Intronic
1065382391 10:25103158-25103180 GGGGGGGTTGGGAGAGAAGAGGG - Intergenic
1065406755 10:25375300-25375322 GTATGGGTTGGGAGAAATGATGG - Intronic
1066506477 10:36049800-36049822 ATTTGGGTGGGGAGGGATGAAGG + Intergenic
1067267378 10:44757455-44757477 GAGGGGGTTGGGAGAGATGGGGG - Intergenic
1067545270 10:47188237-47188259 GTGGAGGTGGGGAGAGAAGAGGG + Intergenic
1067566324 10:47340253-47340275 GCCTGGGTGGGGAGTGATGAAGG + Intergenic
1068358437 10:55942828-55942850 GTGTGGGTAGGGAGTGGGGCAGG + Intergenic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069273847 10:66565388-66565410 ATGTGGGAACTGAGAGATGAGGG + Intronic
1069936685 10:71922273-71922295 TTGGGAGTAGGGAGAGATGGAGG + Intergenic
1070065269 10:73027645-73027667 GAGGGGGGAGGGAGAGAGGAAGG + Intronic
1070368664 10:75760689-75760711 GGGTGGATAGGGAAGGATGAGGG + Intronic
1071078829 10:81784981-81785003 ATGTGGGTAGGGCCAGATAAGGG + Intergenic
1071574630 10:86716434-86716456 GTGTAGGTGGGGACAGGTGAGGG - Exonic
1071954478 10:90743163-90743185 GGGTGGGTAGGTGGAGATTAGGG - Intronic
1072305590 10:94103726-94103748 GTGTGGGTAAGGATAGAAGGAGG - Intronic
1072473709 10:95738032-95738054 TTCTGGGTAGGGAGAAAGGAAGG + Intronic
1072529693 10:96307295-96307317 GGGTTGGTAGGGAGAGATTATGG + Intronic
1072628729 10:97131269-97131291 GTGTGTGTGGTGAGAGATGCCGG - Intronic
1072933860 10:99693082-99693104 GTGTGAGTAGGGTGGGAGGATGG + Intronic
1073559704 10:104486449-104486471 CTCTGGGTAGGGAGAGACCAGGG + Intergenic
1073947599 10:108768836-108768858 GTTTGGGTAGGGAGACATGGTGG + Intergenic
1074296710 10:112195946-112195968 GTGGGGTGAGGGAGAGAAGATGG - Intronic
1074370800 10:112899302-112899324 GTGTGGTTAGGGAGAGAACTGGG - Intergenic
1076731219 10:132440190-132440212 GTGAGGGTAGTGGGAGATGAGGG - Intergenic
1076732751 10:132446643-132446665 GTGGGAGGAAGGAGAGATGAGGG + Intronic
1076862957 10:133150605-133150627 GAGTGGGGAGGGTGAGAGGAGGG + Intergenic
1076964111 11:65401-65423 GTGGGGGTTGGGAGAGGTGGGGG + Intergenic
1077195692 11:1278915-1278937 GTATGGGCAGGGACAGGTGATGG - Intronic
1077195707 11:1278977-1278999 GTGTGGGCAGGGACAGGCGATGG - Intronic
1077232025 11:1462032-1462054 GTGTGGGGAGGGCCAGCTGAGGG - Intronic
1077307031 11:1873063-1873085 GTGGAGGCAGGGAGAGATGGAGG + Intronic
1077479334 11:2806295-2806317 GAGAGGGGAGGGAGAGAGGAAGG + Intronic
1078142872 11:8704263-8704285 ATGTGGGTGGGGAGAGGTCAGGG + Intronic
1078390555 11:10932123-10932145 GTGTGGGAAGAGAGAGTGGAGGG + Intergenic
1078748589 11:14138841-14138863 GTTTGGGTGTGGAGAGATCAAGG - Intronic
1078929049 11:15899388-15899410 GTGGGGCAAGGGTGAGATGAGGG + Intergenic
1079133446 11:17762811-17762833 GGGTGGGAATGGAGAGACGAAGG - Intronic
1079327344 11:19505568-19505590 GAGTGGGGAGAGAGAGAAGAAGG + Intronic
1079407125 11:20156839-20156861 GTCGGGGTGGGGAGAGAAGAGGG + Intronic
1079488812 11:20964643-20964665 GTGTGGGTAGTGGAAGAAGAGGG - Intronic
1079977510 11:27110223-27110245 GTAGGAGGAGGGAGAGATGATGG - Intronic
1080021679 11:27567074-27567096 GTGTAGGTAAGGGGAGATAAAGG + Intergenic
1080561755 11:33470527-33470549 GGGTGAGGAGGGAGAGGTGAAGG - Intergenic
1080591236 11:33724602-33724624 GTGTGGGGAGGGAGTGTTGGGGG + Intronic
1080653091 11:34238128-34238150 GTGTGGGTAGCCAGAGAGGCTGG - Intronic
1081136032 11:39441586-39441608 ATGTGGGTAGGGCCAGATAAGGG - Intergenic
1081729457 11:45359532-45359554 GTGTTGGGATGGAGAGGTGATGG + Intergenic
1081830489 11:46107910-46107932 GAGTGAGTAGGGATAGGTGATGG + Intronic
1081855274 11:46299416-46299438 ATGTGGGAAGGGAGTGATGCAGG - Intronic
1082755503 11:57072086-57072108 GAGTGGTTAGGGAGGGGTGATGG - Intergenic
1083628266 11:64082902-64082924 GTCAGGGCAGGGACAGATGAGGG - Intronic
1083645075 11:64167357-64167379 GTGGGGGCGGGTAGAGATGAGGG - Intergenic
1083893399 11:65608098-65608120 GTGGGGGTTGGGAGAGAAAAGGG - Intronic
1084756192 11:71240374-71240396 GAGGGGCTAGGGAGAGAAGATGG - Intronic
1085283721 11:75346714-75346736 GCCTGGGTATGGAGAGAAGAGGG - Intronic
1085641800 11:78197362-78197384 GTGAGGGTCTGGAGAGGTGATGG + Intronic
1085858136 11:80198977-80198999 CTATGGAGAGGGAGAGATGAGGG - Intergenic
1085886835 11:80532186-80532208 ATGTGGGTAGGGTCAGATAAGGG - Intergenic
1086742919 11:90389959-90389981 GTAGGGGTAGGGGGAGATAAAGG - Intergenic
1086851930 11:91819876-91819898 GGGTGGGTGGAGAGAAATGAGGG - Intergenic
1086889048 11:92235267-92235289 GAGAGGGTTGGGAGAGATAAAGG - Intergenic
1087597433 11:100272276-100272298 GTGTGTGTAGGGGGACATAAAGG - Intronic
1087675088 11:101152507-101152529 GTGGGGGTAGGGAGAGCATAAGG - Intergenic
1087683681 11:101240682-101240704 ATGTGGGTAGGGCCAGATAAGGG - Intergenic
1088321604 11:108560015-108560037 GTGTGGGTAGGGTGGGAAGGAGG - Intronic
1088689784 11:112315866-112315888 ATGTGGGTGGGGAGAGGTGCTGG + Intergenic
1089004009 11:115075557-115075579 GCCGGGGGAGGGAGAGATGAGGG + Intergenic
1089500862 11:118930380-118930402 GTGTGGGTGGGGAAAGAGGAGGG + Intronic
1090112176 11:123924695-123924717 TTGTGGGTGGTGTGAGATGAGGG + Intergenic
1090947845 11:131447753-131447775 TTGGGGGAAGGGAGAGAAGAGGG + Intronic
1091314810 11:134606829-134606851 GTGAGGGTGGGGAGTGCTGAAGG + Intergenic
1091320789 11:134647875-134647897 GAGAGGGGAGGGAGACATGAAGG - Intergenic
1091903814 12:4166299-4166321 GTTTTGGTAGGGGGAGGTGATGG - Intergenic
1092474894 12:8810077-8810099 ATGAGGGTATGGAGAGATAATGG - Intergenic
1093998600 12:25670163-25670185 TTAAGAGTAGGGAGAGATGATGG + Intergenic
1094166669 12:27450287-27450309 GTGGGGGCAGGGAGGGAGGAGGG - Intergenic
1094763413 12:33561706-33561728 GTGTGGGCATGGTGGGATGATGG - Intergenic
1095617375 12:44206812-44206834 GAGTGGGGAGGGTGAGAGGAGGG + Intronic
1096186862 12:49587247-49587269 GTGTAGGGAGGGAGAGATGAGGG - Intronic
1096623637 12:52879799-52879821 GGGTGGGTGGGGGGAGCTGAGGG - Intergenic
1096670810 12:53197330-53197352 GGGTGTCTAGGGAGAGATGCAGG + Intronic
1097262658 12:57728194-57728216 GTGGGGGTAGGGAAAGCAGAGGG + Intronic
1097636374 12:62127309-62127331 GAGTGGGTAGGGAATGATGGAGG - Intronic
1097880674 12:64683464-64683486 GTGTGGGGAGGTAGAGAAGTGGG + Intronic
1098078303 12:66757225-66757247 GTGTGGGAGGGAAGAGAGGAGGG - Intronic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG + Intergenic
1100339590 12:93665688-93665710 GTGGGAGTAGGGGGAGAGGAAGG - Intergenic
1100672112 12:96824710-96824732 GTTTGGGTAGGAAGTGATCACGG - Intronic
1100712799 12:97275834-97275856 GAGTGGGGAGGGACAGACGAGGG - Intergenic
1100984163 12:100188991-100189013 ATGTGGGCAGGGACAAATGAGGG - Intergenic
1101058588 12:100946878-100946900 GTGTGGTTCAGGAGAGATGGAGG + Intronic
1101332990 12:103772050-103772072 CTGTGGGTGGGGGGAGATGGGGG + Intronic
1101898338 12:108772170-108772192 AAGTGGGCAGGGAGAGAAGAGGG + Intergenic
1101975245 12:109352352-109352374 GAGTGGGAGGTGAGAGATGAGGG - Intronic
1102212627 12:111138361-111138383 GTGGGGGTGGGGAGAGAGGAGGG + Intronic
1102457891 12:113082205-113082227 GCGTGGGTGGGGAGGGATGAGGG - Intronic
1103012401 12:117467138-117467160 GAGTAGGGAGGGAGAGGTGACGG + Exonic
1103238814 12:119397311-119397333 GTGTGGGTAGGGCCAGATAAGGG - Intronic
1103245057 12:119449720-119449742 GTGTGGGAAGGGAGAGTGCATGG + Intronic
1104214125 12:126719324-126719346 GTGTGTGTCGGGGGAGAGGAAGG + Intergenic
1104414827 12:128589404-128589426 GTGTGGGTTGGGAGGGAGGCAGG - Intronic
1104743053 12:131193036-131193058 GTGTGTGCATGGACAGATGAGGG + Intergenic
1104948715 12:132429177-132429199 GTGTGGTCAGGGAGGGAGGAGGG - Intergenic
1105007349 12:132729553-132729575 GTGAGGGAAGGGGGAGATGAGGG + Intronic
1105418765 13:20234694-20234716 GTGGGGGTGGAGAGAGAGGAAGG + Intergenic
1105455789 13:20540067-20540089 ATGTGGGTGGGGACAGATAAGGG - Intergenic
1105685209 13:22774222-22774244 GTGTGGGTAAGGAGAGAGCTGGG + Intergenic
1105777519 13:23677457-23677479 GTGTGGGTGGGGCCAGATAAGGG - Intergenic
1106073833 13:26440398-26440420 GAGTGGGTAGGGAGAGATGTAGG + Intergenic
1106370688 13:29129854-29129876 GTGGGGGCAGGGTGAGGTGAGGG + Intronic
1107944843 13:45408948-45408970 GTGAGGATAGGCAGAGAAGAAGG - Exonic
1108618974 13:52162423-52162445 GTGAGGGTAGGGAGAGGGGATGG + Intergenic
1108740337 13:53330888-53330910 GTGAGGGGGGTGAGAGATGATGG - Intergenic
1109326473 13:60873309-60873331 GTGTGGATAGGGAAAGAGGTTGG + Intergenic
1109416304 13:62045896-62045918 ATGTGGGTGGGGTCAGATGAGGG - Intergenic
1110113156 13:71776903-71776925 GTCTGGGTGGGGAGTGATGAAGG - Intronic
1110440336 13:75519422-75519444 ATGTGGGTAGGGCCAGATAAAGG + Intergenic
1110457231 13:75703146-75703168 GTGTGTGTTGGGGGGGATGAGGG - Intronic
1111202526 13:84959281-84959303 GTGGGGGAATGGAGAGATGTTGG - Intergenic
1111786921 13:92799745-92799767 GTGTGTGAAGGGAGAGAAAAAGG - Intronic
1111806514 13:93044989-93045011 GTGTTGGGGTGGAGAGATGAGGG - Intergenic
1111813312 13:93119389-93119411 GTTGGGGCAGGAAGAGATGAAGG + Intergenic
1112330232 13:98471793-98471815 GGGTGGGTTGGGAGAAGTGATGG - Intronic
1112427124 13:99312804-99312826 GTGTGTGTTGGGCCAGATGAGGG + Intronic
1112667010 13:101586269-101586291 GTAGGGGTAGGAAGAGGTGATGG + Intronic
1112695915 13:101947685-101947707 GAGGGGGTAGGGAGGGATCATGG + Intronic
1113023207 13:105911528-105911550 GTATAGGTTGGGAAAGATGATGG + Intergenic
1113850813 13:113416929-113416951 GTGTGTGCAGTGAGAGATGAGGG + Intergenic
1113932270 13:113974680-113974702 GTGTGGGTGGGGAGAGGCGCTGG - Intergenic
1114491763 14:23106796-23106818 CTGTGCTTTGGGAGAGATGAGGG - Intergenic
1114567835 14:23645477-23645499 GTGTGGGTCTGGGGAGCTGAAGG + Exonic
1115590260 14:34857520-34857542 GTGTGGGAAAGGAGAAATCATGG - Intronic
1116623577 14:47237814-47237836 TTGTGTCTAGGGAGAGATGATGG - Intronic
1117665309 14:58050403-58050425 GAATGGGTAGAGAGAGAGGAAGG - Intronic
1117960486 14:61157036-61157058 GAGTGGGAAGGAAGAGATGTGGG + Intergenic
1118105327 14:62652726-62652748 TTTGGGGTGGGGAGAGATGAGGG - Intergenic
1118321876 14:64758133-64758155 GGGTGGATAGGGAGGGGTGAAGG - Intronic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118709816 14:68510042-68510064 GTGGGGCTAGGGGGAGGTGAGGG - Intronic
1118734150 14:68690184-68690206 GAGGGGGTAGGGAGAGGTGCTGG + Intronic
1119364950 14:74084024-74084046 GTGGGCGGATGGAGAGATGAGGG + Intronic
1119415018 14:74464164-74464186 TTGTGGGTAGGGAGTGAAAAAGG + Intergenic
1119723267 14:76905938-76905960 GTTTTGGTAGGGGGTGATGAGGG + Intergenic
1120229628 14:81828899-81828921 ATGTGGGTGGGGACAGATAAGGG - Intergenic
1120539064 14:85732914-85732936 GTGGTGGTATGGAGAGATAATGG + Intergenic
1122258417 14:100497907-100497929 GTGAGGGCTGGGAGACATGATGG + Intronic
1122437881 14:101711887-101711909 CGGTGGGTGGGGAGAGATGATGG - Intergenic
1122437887 14:101711907-101711929 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122437893 14:101711927-101711949 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122437899 14:101711947-101711969 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122437905 14:101711967-101711989 TGGTGGGTGGGGTGAGATGACGG - Intergenic
1122437927 14:101712022-101712044 CGGTGGGTGGGGAGAGATGGTGG - Intergenic
1122437934 14:101712042-101712064 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122437940 14:101712062-101712084 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122437946 14:101712082-101712104 CAGTGGGTGGGGTGAGATGACGG - Intergenic
1122437977 14:101712198-101712220 CGGTGGGTGGGGAGAGATGATGG - Intergenic
1122437988 14:101712238-101712260 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122437999 14:101712278-101712300 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438010 14:101712318-101712340 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1122438021 14:101712358-101712380 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438027 14:101712378-101712400 CAGTGGGTGGGGTGAGATGACGG - Intergenic
1122438043 14:101712438-101712460 CAGTGGGTGGGGTGAGATGACGG - Intergenic
1122438066 14:101712518-101712540 CAGTGGGTGGGGAGAAATGACGG - Intergenic
1122438076 14:101712558-101712580 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438091 14:101712614-101712636 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438106 14:101712670-101712692 CGGTGGGTGGGGTGAGATGATGG - Intergenic
1122438112 14:101712690-101712712 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438118 14:101712710-101712732 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438124 14:101712730-101712752 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438130 14:101712750-101712772 TGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438142 14:101712790-101712812 ATGACGGTGGGGAGAGATGACGG - Intergenic
1122438146 14:101712806-101712828 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438152 14:101712826-101712848 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438158 14:101712846-101712868 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438170 14:101712886-101712908 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438176 14:101712906-101712928 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438182 14:101712926-101712948 CAGTGGGTGGGGGGAGATGACGG - Intergenic
1122438204 14:101713002-101713024 CAGTGGGTTGGGAGAGATGACGG - Intergenic
1122438221 14:101713074-101713096 CGGTGGGTGGGGGGAGATGACGG - Intergenic
1122438229 14:101713094-101713116 CAGTGGGTGGGGGGAGATGACGG - Intergenic
1122438298 14:101713362-101713384 CGGTGGGTCCGGAGAGATGACGG - Intergenic
1122438302 14:101713382-101713404 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438313 14:101713422-101713444 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438319 14:101713442-101713464 CGGTGGGTGGGGGGAGATGACGG - Intergenic
1122438327 14:101713462-101713484 CAGTGGGTGGGGGGAGATGACGG - Intergenic
1122438340 14:101713502-101713524 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438346 14:101713522-101713544 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438352 14:101713542-101713564 CAGTGGGTGGGGTGAGATGACGG - Intergenic
1122438382 14:101713654-101713676 CAGTGGGTGGGGTGAGATGACGG - Intergenic
1122438397 14:101713710-101713732 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1122666232 14:103332471-103332493 GTGTTGGTAGGAAGAAATAAAGG - Intergenic
1122825747 14:104369649-104369671 GTGAGGGGAGGGAGAGATGGAGG - Intergenic
1122886781 14:104713773-104713795 GTGAGTGGAGGGAGGGATGAGGG - Intronic
1122903736 14:104792551-104792573 GCCTGGGGAGGGAGAGATGGGGG - Intronic
1124222890 15:27865245-27865267 GTGTAGGTGGGGAGAGCTGGCGG - Intronic
1124551186 15:30682715-30682737 GTGTGGATAGGAAGAGAGCAGGG - Intronic
1125180605 15:36878381-36878403 GTGGGGGTTGGGTGAGGTGAAGG - Intergenic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1125883868 15:43214213-43214235 GAGTGGGGAGGAAGAGAAGATGG + Intronic
1126457923 15:48884816-48884838 CTCTGGGAAGGGAAAGATGAGGG - Intronic
1126663104 15:51051755-51051777 CTTTGGGTTGGGGGAGATGAGGG - Intergenic
1127288188 15:57548642-57548664 GGTTGGGTAGGGAGAGTTGTAGG + Exonic
1127836964 15:62797756-62797778 GTGTGGGCAGGGGGAGGTGGAGG + Intronic
1128010699 15:64293175-64293197 GTGTAGGTAGGAGGACATGATGG - Intronic
1128056711 15:64705002-64705024 GAGTAGGTAGGGATAGCTGAGGG - Intergenic
1128233946 15:66054382-66054404 GTGGGGGCAGGTGGAGATGAGGG - Intronic
1128579044 15:68796016-68796038 GTGTGGAAAAGGGGAGATGAAGG + Intronic
1128721731 15:69955297-69955319 GTGGGAGTAGGGAGAGGAGAAGG - Intergenic
1128729868 15:70013889-70013911 GTGTGGGCAGGGAGAGAGGGAGG + Intergenic
1128793433 15:70449211-70449233 GTGGAGGGAGGGAGAGATGGAGG + Intergenic
1129107552 15:73320040-73320062 GTGTGTGTAAGTAGAGAAGAGGG + Exonic
1129236174 15:74225055-74225077 GTGAGGAAAGGCAGAGATGAAGG - Intergenic
1129281677 15:74490032-74490054 GTGTGGGGGGTGAGAGATGGGGG - Intergenic
1129688872 15:77701950-77701972 GTGTGGTTTAAGAGAGATGAAGG + Intronic
1129770649 15:78201330-78201352 GTGAGGTGGGGGAGAGATGAAGG - Intronic
1129832792 15:78681664-78681686 TAGAGGGGAGGGAGAGATGAGGG + Intronic
1129906915 15:79194949-79194971 ATGTGAGTTTGGAGAGATGATGG - Intergenic
1130162413 15:81414535-81414557 ATGTGGGTAGGGTCAGATAAGGG + Intergenic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130303745 15:82699434-82699456 GTATGAGTGAGGAGAGATGAGGG - Intronic
1130322787 15:82854583-82854605 GTGTGGGCAGTGGGAGATGGGGG - Intronic
1130368889 15:83266252-83266274 GTGTGGGGAGGGAGGGAGGGAGG + Intronic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1131841842 15:96445705-96445727 GTGCCGGTGGGGAGGGATGAGGG + Intergenic
1131904949 15:97133107-97133129 GTGTGTGTTTGGAGAGATGGTGG + Intergenic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132444440 15:101899782-101899804 GTGGGGGTTGGGAGAGGTGGGGG - Intergenic
1132471217 16:104435-104457 CTATGGGTATGGAGAAATGAGGG + Intronic
1132574619 16:658731-658753 GTGGGGGCAGGGAGAGCAGAAGG + Intronic
1132607511 16:799823-799845 GAGTGGGTAGGGGGAGAGGCAGG - Intronic
1133550371 16:6848615-6848637 ATGTGTGTAGAGAGAGATGATGG + Intronic
1133586020 16:7196334-7196356 GGGTGGGTAGGAAAAGTTGAAGG - Intronic
1134819757 16:17237393-17237415 GTGTGGGAAGGCAGAGGAGAGGG - Intronic
1134826040 16:17285163-17285185 GTGTTGCTGGGGAGGGATGAGGG + Intronic
1135197939 16:20409870-20409892 GTGAGGGGCGGGAGAGGTGAGGG + Intronic
1135197945 16:20409886-20409908 GTGAGGGGCGGGAGAGGTGAGGG + Intronic
1135197951 16:20409902-20409924 GTGAGGGGCGGGAGAGGTGAGGG + Intronic
1135521189 16:23179666-23179688 GTGTGAGTAGGAAGAGACGAGGG + Intergenic
1135583679 16:23650427-23650449 GTGTGGGGAGGGAGGGAGGCAGG - Intronic
1135621807 16:23962332-23962354 GTGGGGGTTGGGACGGATGAGGG - Intronic
1135775077 16:25250469-25250491 GCTTGGGTAAGGGGAGATGATGG + Intronic
1135778644 16:25279352-25279374 TAGTGGGGAGGAAGAGATGAGGG + Intergenic
1135839200 16:25859023-25859045 GTGTGGGGTGGGAGGGATGTTGG - Intronic
1135912059 16:26570515-26570537 GTGGGTGGAGGGAGAGATGGTGG - Intergenic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1137625366 16:49904362-49904384 GTGTGTGGACTGAGAGATGAGGG - Intergenic
1137742175 16:50789459-50789481 GAGTGGGTAGGGAGGGATCAGGG + Intronic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1138750740 16:59417136-59417158 GTGTGGATAGGGACAGAGAATGG - Intergenic
1139099158 16:63744493-63744515 GTGTGGGGAAGGAGAGGTGATGG - Intergenic
1139146030 16:64326817-64326839 GTGAGAGTAGGGAGAAGTGATGG - Intergenic
1139475428 16:67200376-67200398 GTGTGGGCTGGGGGAGATGGTGG + Intronic
1139550922 16:67672586-67672608 GTGTGGATAGGGAGGGATCTTGG + Intergenic
1139676299 16:68526277-68526299 GAGTGGGGAGGAAGAGATGAGGG - Intergenic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1140132429 16:72175302-72175324 GTGTGGTTTTGGAGAGAGGAAGG + Intronic
1140704086 16:77609913-77609935 GTGAGGGTTGGAAGAGATGCAGG - Intergenic
1141509666 16:84504439-84504461 GTCGGGGGAGGGAGAGGTGAAGG - Intronic
1141610587 16:85178876-85178898 GGGTGGGCAGGGAGGGATGAGGG + Intronic
1141708040 16:85680134-85680156 GTGTGGTGCGGGAGAGATGTGGG - Intronic
1142419382 16:89961100-89961122 GTGGTGGCAGGGAGAGAAGAGGG + Intronic
1142605595 17:1079428-1079450 GTGGGGGCTGGGAGAGGTGAGGG - Intronic
1142761111 17:2042351-2042373 GTATGGGTCGCGAGAAATGAAGG - Intronic
1142989282 17:3718763-3718785 GCATGGGAAGGGAGAAATGAAGG + Intronic
1143183937 17:4999544-4999566 GGGTGGGAAGAGAGAGAGGAGGG - Intronic
1143287407 17:5800546-5800568 GTGTGGCTAGGGCTGGATGAAGG + Intronic
1143358787 17:6350991-6351013 GTGTGGGTAGGGGAAGATTCTGG - Intergenic
1143854285 17:9837232-9837254 GTGGAGGTGGGGAGGGATGATGG - Intronic
1144583748 17:16475314-16475336 GTGTGTGTGGAGAGAGAGGAAGG + Intronic
1144770733 17:17758019-17758041 CTCTGGAAAGGGAGAGATGAGGG - Intronic
1144942044 17:18948562-18948584 GTTTGGGTGGGGAGTGATGGAGG + Intergenic
1145958790 17:28873350-28873372 GTGGGGGTAGGGAGTGAGGAGGG - Intergenic
1146491132 17:33283163-33283185 GTGTGCCTGGGGAGAGATGCTGG - Intronic
1146685325 17:34837569-34837591 GTGTTGGAAGGCTGAGATGATGG + Intergenic
1146815273 17:35937208-35937230 GTGTGCGAAGGCAGAGGTGAGGG + Intronic
1148638248 17:49165574-49165596 GAGTGGGGAGGGAGAGAGAAAGG - Intronic
1148912825 17:50952246-50952268 GTGTGGGGAGAGGGAGGTGAAGG - Intergenic
1149597615 17:57873527-57873549 GTGTGGGCAAAGAGAGATGCTGG + Intronic
1150628610 17:66859846-66859868 GGGTGGAGAGGGAGAGAAGAGGG - Intronic
1150947682 17:69765588-69765610 GAGGGGGAAGGGAGAGAGGAAGG - Intergenic
1151452292 17:74205457-74205479 TTGGGGGTAGGCAGAGATGGGGG + Intronic
1152131982 17:78483102-78483124 GTGTGGGGTGGGAGATTTGAGGG - Intronic
1152480219 17:80545879-80545901 GTGTGGCTAGGGGGAAATGTCGG - Intronic
1152482210 17:80562063-80562085 TTGAGGGTAGGAGGAGATGAGGG + Intronic
1152851624 17:82639874-82639896 GTGTGGGTCGGGAGGGCTGCTGG + Intronic
1153101322 18:1473219-1473241 GAGTGGGGAGGGAGAGAGGAAGG + Intergenic
1154064783 18:11096637-11096659 GTGTTGGGTGGGGGAGATGAGGG - Intronic
1155075666 18:22351917-22351939 GTTTGGGTGGTGGGAGATGAAGG + Intergenic
1156276901 18:35592517-35592539 ATGGGGGTGGGGTGAGATGAAGG + Intronic
1156625303 18:38901070-38901092 GTGTGGGGAGAGAGAGAAGAAGG + Intergenic
1157231428 18:45920110-45920132 GAGTGGGTAAGGGGAGAGGAAGG - Intronic
1157714495 18:49874082-49874104 GTGTGGGTTGGGAGAGGGTATGG - Intronic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1157818638 18:50749523-50749545 CCGTGGGGAGGGTGAGATGAGGG - Intergenic
1157894948 18:51457075-51457097 GGGTGGGTGGGGAGAGCTGAGGG - Intergenic
1158315972 18:56211443-56211465 GTGTGTGTAGGGAGGAAGGAAGG - Intergenic
1158435273 18:57430850-57430872 GTGAGGGCAGGGAGAGATATGGG - Intergenic
1158497524 18:57969992-57970014 ATGTGGGTGTGGAGTGATGAAGG - Intergenic
1158597286 18:58827613-58827635 ATGTGGGTGGGGCCAGATGAGGG - Intergenic
1159966743 18:74602294-74602316 GAGAAGGTAGAGAGAGATGATGG + Intronic
1159994998 18:74955829-74955851 GTGTGTGCAGGGAGAGAGGATGG - Intronic
1160008355 18:75085345-75085367 GGGTGGGTAGGCAGAGTGGAGGG - Intergenic
1160051841 18:75440966-75440988 GTGTGGTGAGGGAGGGATGGAGG + Intergenic
1160640914 19:135033-135055 GTGGGGGTTGGGAGAGGTGGGGG + Intergenic
1161088707 19:2347110-2347132 GTGTGTGGAGGGAGAGAGAACGG - Intronic
1161088810 19:2348515-2348537 GTGTGTGGAGGGAGAGAGAACGG - Intronic
1161813126 19:6481982-6482004 GAGCGGGGAAGGAGAGATGAGGG - Intronic
1161847444 19:6719826-6719848 GTTTGGGTAGGTAGAGTTGAGGG - Intronic
1162101284 19:8340746-8340768 GAGTGGGAAGGGAGAGGTCAGGG - Intronic
1162184454 19:8894195-8894217 GTGGGGCCAGGGAGGGATGATGG + Exonic
1163775861 19:19217037-19217059 TTGTGGGGAGGGAGAGATTGGGG + Intronic
1164203767 19:23040904-23040926 GTGTGTGTAAGGGGAGTTGATGG - Intergenic
1164465167 19:28481707-28481729 GTTTGATTAGGGAGAGATGTGGG - Intergenic
1164832594 19:31333972-31333994 GTGTGGGTGGGGAGGGAGCAAGG - Intronic
1164884692 19:31768408-31768430 ATGTGGGAAGGGGGAGAGGAGGG + Intergenic
1164941221 19:32253325-32253347 GTATGGGAAGAGAGAGAGGATGG - Intergenic
1165111682 19:33506107-33506129 GTGTGTGTAGGGTGTAATGAGGG - Intronic
1165154075 19:33777031-33777053 CTGAGAGTAGGGGGAGATGATGG - Intergenic
1165773218 19:38390016-38390038 GGGTGGGGACGGAGAGATGGGGG + Intronic
1165826694 19:38709711-38709733 GTATGGGGAGGGGGAGCTGAAGG + Intronic
1165846747 19:38822788-38822810 ATGTGGGTGGGGACAGATAAGGG + Intronic
1165855825 19:38878868-38878890 GTGGGGGCAGTTAGAGATGAGGG + Exonic
1166900364 19:46056900-46056922 GGGTGTATAGGGAGAGAAGAGGG - Intronic
1166970573 19:46564502-46564524 GTGAGGGTAGGGGGAGAGGGAGG + Intronic
1166981577 19:46634836-46634858 GTGGAGGGAGGGACAGATGAAGG + Intergenic
1167200532 19:48062067-48062089 GAGTGGGAAGGGAGTGTTGATGG + Exonic
1167428776 19:49442797-49442819 GGGAGGGTAGGGAGAGATCCAGG - Intergenic
1167631024 19:50626246-50626268 GTGAGGGGAGAGAGAGAGGAGGG + Intronic
1167689884 19:50978780-50978802 GAGGGGGCAAGGAGAGATGAGGG + Intronic
1167773909 19:51542576-51542598 GTCTGTGTTGGGAGAGATGGAGG + Intergenic
1168309955 19:55455331-55455353 CTGTGGGTAGAGAGAGGTCAGGG + Exonic
925149902 2:1607721-1607743 GTCTGGGCAGGCAGAGAGGAAGG + Intergenic
925363255 2:3294440-3294462 GTGTGTGTTTGGAGAGAGGATGG - Intronic
925363298 2:3294638-3294660 GTGTGTGTTTGGAGAGAGGATGG - Intronic
925363484 2:3295554-3295576 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925363498 2:3295619-3295641 GTGTGTGTATGTAGAGAGGATGG - Intronic
925363517 2:3295719-3295741 GTGTGTGTATGTAGAGAGGATGG - Intronic
925363670 2:3296447-3296469 GTGTGTGTGTGGAGAGAGGATGG - Intronic
926783608 2:16498534-16498556 GTGGGAGGAGGGAGAGATCAGGG - Intergenic
926893241 2:17657185-17657207 CTGTAGGCAGGGAGAGATCAGGG + Intergenic
926918459 2:17915897-17915919 TTGTGGGGAGGGAGAGAGAAAGG + Intronic
927048060 2:19299942-19299964 GAGAGGGTAGGAAGAGAGGAAGG - Intergenic
927074822 2:19567141-19567163 GAGTGGGAAGGTAGAGGTGAGGG + Intergenic
927466138 2:23338101-23338123 GTGTGGAGAGGGAGAGTGGATGG + Intergenic
927605266 2:24481199-24481221 CTGTTGGTGGGGAGAGAGGATGG - Intergenic
927944891 2:27129688-27129710 ATGTGGGTTGGGACAGAGGAAGG - Intronic
928926537 2:36585505-36585527 GGGTGGGGAGGGAGAGCAGAAGG + Intronic
929107385 2:38377759-38377781 GGGTGGATGGGGAGAGAGGAGGG - Intergenic
929444769 2:41993026-41993048 GTGCGGGGAGGGAGAAAAGATGG - Intergenic
930234737 2:48877700-48877722 GGGTGGGTAAGCAGAGAGGAAGG - Intergenic
930245802 2:48982247-48982269 GTGTAGGTAAGAAGAGAAGATGG + Intronic
930576086 2:53150517-53150539 GTGTGGGTGGGGAGAGAGGGAGG + Intergenic
930752228 2:54945139-54945161 GGAGGGGTAGGGAGGGATGAGGG - Intronic
931090347 2:58879020-58879042 ATGTGGGCAGGGAGAAATCAGGG + Intergenic
931283905 2:60816943-60816965 GTGTGGCCATGGAGAGATCAGGG - Intergenic
931324400 2:61203693-61203715 GTGTGGGTAAAGAAAGATAAAGG + Intronic
931348937 2:61471180-61471202 GTGTGCGGAGGGAGAGGTGGGGG - Intergenic
931635203 2:64334328-64334350 GGGTGGGCAGGGAAAGAAGAGGG - Intergenic
931924030 2:67051689-67051711 GGGAGGGAAGGGAGGGATGAAGG - Intergenic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
932355831 2:71067990-71068012 GGGTGGGTAGGAAGAGGTGAAGG + Intronic
932531101 2:72533542-72533564 GACTGGGTAGTGAGAGATGATGG - Intronic
933415941 2:81985922-81985944 ATGTGGGTGGGGACAGATAAGGG + Intergenic
933759715 2:85665204-85665226 GTGTGAGTTGGGAGAGAGGTGGG + Intronic
933980220 2:87543159-87543181 GGGTGGGTAGGGTGAGGGGAGGG + Intergenic
933983130 2:87569881-87569903 GTTGGGGTAGGGAGAGCTGAAGG - Intergenic
934504641 2:94880686-94880708 GGGTGGGCAGGGAGAGCAGAGGG - Intergenic
935088270 2:99869428-99869450 GTGGGGGTGGGAAGAGAGGAGGG + Intronic
935154770 2:100474328-100474350 CTGTGGGTTGGGGGAGGTGAGGG - Intronic
935271130 2:101435317-101435339 GTGTGTTTCGGGAGGGATGAGGG + Intronic
936310714 2:111380913-111380935 GTTGGGGTAGGGAGAGCTGAAGG + Intergenic
936313606 2:111407632-111407654 GGGTGGGTAGGGTGAGGGGAGGG - Intergenic
936679797 2:114757147-114757169 GGGTGGGGAGGGAGAGAGGTGGG + Intronic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937317547 2:120941567-120941589 GTTTGGGGAGGAAGAGATGCAGG + Intronic
937797386 2:126039940-126039962 GTGTGGGCAGGGGGAGCTGGGGG - Intergenic
938219104 2:129550476-129550498 GTGAGGGGAGGGACAGACGAGGG - Intergenic
939005811 2:136785421-136785443 GTGTGGGGACAGTGAGATGAGGG + Intronic
939220823 2:139299543-139299565 GAGTGGGTGGAGACAGATGATGG - Intergenic
939417373 2:141916767-141916789 GAGTGGGAAGGGAGAGAGGACGG + Intronic
940020173 2:149147936-149147958 GTGTGTATAGTCAGAGATGATGG + Intronic
941695406 2:168545887-168545909 GTGTGGGAAGGGGAGGATGAGGG + Intronic
941878480 2:170459232-170459254 ATGTGGGTAGGGTCAGATTAGGG - Intronic
942729848 2:179052059-179052081 GGGATGGTATGGAGAGATGATGG + Intergenic
943730795 2:191301347-191301369 GGCTGAGAAGGGAGAGATGAGGG + Intronic
944398609 2:199299175-199299197 GTGTGGTCAGGGAGAAATTAGGG + Intronic
944662522 2:201933109-201933131 GTGTGTGTAGGGAGGCATGCGGG + Intergenic
946156328 2:217809134-217809156 GGGTGGTAAGGGATAGATGAGGG + Intronic
946299655 2:218814783-218814805 GTGTGGGCAGGGAGGGGTGGAGG + Intronic
946316302 2:218915512-218915534 TTGTGGGTAAGGAAAGATAAAGG + Intergenic
947505596 2:230706127-230706149 GTGTGGGTAGGGTGGAAGGATGG + Intergenic
947572765 2:231249036-231249058 AGGTGAGTAGGGAGAGAAGAAGG + Intronic
948540685 2:238689830-238689852 GTGTAGGAAGGGAGGGAGGAGGG + Intergenic
948786703 2:240356387-240356409 GTGTGGGAAGGGTGTGAAGAGGG + Intergenic
948886444 2:240887444-240887466 GTGTGGGCAGGGTGCGGTGAGGG - Intronic
1168779926 20:480272-480294 GTGTGTGTAGGGAGAGAAAGGGG + Intronic
1169255013 20:4090607-4090629 GTATGGGCAGGGAGAAATGATGG - Intergenic
1169308359 20:4514443-4514465 GTGCATGTAGGAAGAGATGAGGG + Intergenic
1169514252 20:6298933-6298955 ATGTGGGTAGTGAGAAATAAAGG + Intergenic
1169902980 20:10571585-10571607 GGGTGAGCAGGGAGAGAGGAAGG - Intronic
1169939801 20:10924757-10924779 GGGTGGGAAGGGAGACATCAGGG - Intergenic
1170045700 20:12083179-12083201 GGGTGGGAAGGATGAGATGACGG - Intergenic
1170697919 20:18676590-18676612 GGGTGGGTAGAGACAAATGAAGG - Intronic
1170747281 20:19111459-19111481 CAGTGGGTGGGGAGAGAGGAAGG + Intergenic
1171022879 20:21602698-21602720 CTGTGGGTAGGGAGGGCTGGAGG + Intergenic
1171151924 20:22834951-22834973 GTGTAGGGAGGGAGAGAAGGAGG - Intergenic
1171180526 20:23087662-23087684 GTGTGGGTCAGGGGAGATGCAGG + Intergenic
1171340401 20:24422676-24422698 GTGTGGGTCAGGGGAGATGCAGG - Intergenic
1172083021 20:32357921-32357943 GTGCGGGTGGGGAGTGAGGATGG - Intergenic
1172113950 20:32562954-32562976 GGGTGGGGAGGGAGAGTGGAGGG + Intronic
1172448605 20:35006210-35006232 TTGTGGGTAGGGAGTGAGGGTGG - Intronic
1172845880 20:37929789-37929811 ATGTGGGAAGGGAGAGTGGAGGG + Intronic
1172864541 20:38085691-38085713 CTTTGGGTCTGGAGAGATGAAGG - Intronic
1173497931 20:43532648-43532670 GTGTGGGCAGTGAGAAAGGAAGG - Intronic
1173534676 20:43800416-43800438 GTGAGGGTGGGGAGAGGGGAAGG + Intergenic
1173854486 20:46241256-46241278 ATCTGGGTAGGCAGAGAAGAAGG + Exonic
1174054882 20:47791655-47791677 GTGTGGGTGGGGAGTGGGGAGGG - Intergenic
1174222052 20:48963820-48963842 GTGTGTGTAGGGACTGATGACGG + Exonic
1174467391 20:50728793-50728815 TTGGGGGTGGGGAGGGATGATGG + Intergenic
1175473652 20:59253030-59253052 TTGTGGGAAGGAAGAGAAGAAGG + Exonic
1175890502 20:62313827-62313849 GAGTGGGCACGGAGAGATGAGGG + Intronic
1175890509 20:62313855-62313877 GAGTGGGCACGGAGAGATGAGGG + Intronic
1175890516 20:62313883-62313905 GAGTGGGCACGGAGAGATGAGGG + Intronic
1175890523 20:62313911-62313933 GAGTGGGCACGGAGAGACGAGGG + Intronic
1175890547 20:62314013-62314035 GAGTGGGCACGGAGAGACGAGGG + Intronic
1175890592 20:62314192-62314214 GAGTGGGCATGGAGAGGTGAAGG + Intronic
1177103131 21:16919400-16919422 GTGATGGTATGGAGAGATAATGG - Intergenic
1177412919 21:20754336-20754358 ATGTGGGACTGGAGAGATGAAGG + Intergenic
1178054669 21:28784781-28784803 ATGTGGGTAGGGCCAGATAAGGG + Intergenic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1178890205 21:36514655-36514677 GTGTGTGTAGAGAGACAGGAGGG + Intronic
1179006549 21:37520279-37520301 ATGTAGATAGGAAGAGATGAGGG + Intergenic
1179090996 21:38265715-38265737 GTGTGGATAGGAAGACATGGAGG + Intronic
1179452520 21:41475577-41475599 GTGGGGTGAGGGAGGGATGAGGG + Intronic
1179608149 21:42531619-42531641 GTGTGGCTATGCAGAGGTGAGGG + Intronic
1180186648 21:46143347-46143369 GGGGGGGTAGGGAGAGAGGGAGG - Intronic
1181086018 22:20439710-20439732 GTGGTGGTTGGGAGAAATGAGGG - Intronic
1182555850 22:31127919-31127941 GTGGGGGATGGGAGAGATGTGGG - Intronic
1182861795 22:33566679-33566701 ATGTGGGCAGGGAGAAATAAGGG - Intronic
1183085279 22:35483339-35483361 GTGAGGGTAGTGATTGATGAGGG - Intergenic
1183266618 22:36830487-36830509 GTGTAGGCAGGGAGAGAGGAGGG - Intergenic
1183381494 22:37492560-37492582 GAGTGGAGAGGGAGAGATGAAGG + Intronic
1183405241 22:37627319-37627341 GAGTGTGGAGGGAGAGCTGAAGG + Intronic
1183590349 22:38776197-38776219 ATGGGGGTGGGGAGAGAGGACGG - Intronic
1184485842 22:44778846-44778868 GTGGGGTTAGAGAGAGAGGAGGG - Intronic
1184552537 22:45212242-45212264 GTGGGGGTCGGGAGTGGTGAGGG - Intronic
1184989278 22:48156220-48156242 CAGTGGGTAGGGAGAGAGGGAGG - Intergenic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
1185228962 22:49669440-49669462 ATGTGGGTGGGGACAGATAAGGG - Intergenic
950293135 3:11803933-11803955 GTGAGGGTGGGAGGAGATGAGGG + Intronic
951355067 3:21656220-21656242 GTGTGGGTAGGCAGATCAGATGG + Intronic
951537209 3:23751025-23751047 GTGTGGGTAGGGAGAGAGGAAGG - Intergenic
951919153 3:27834552-27834574 GTGTGGGGAGGGAGAGAATCAGG - Intergenic
952237536 3:31495587-31495609 GAGTGGCTTGGGAGAGCTGAGGG + Intergenic
952740742 3:36731798-36731820 GTGAGGGGAGGGAGAAAAGAAGG - Intronic
952882061 3:37991387-37991409 GGGTGGGGAGGGAGAGAGGGAGG + Intronic
952995755 3:38880605-38880627 CTGTTTGTAGGGATAGATGAGGG - Intronic
953173788 3:40530861-40530883 GTGTGCGTAGGGGGCTATGATGG - Intronic
953336399 3:42098048-42098070 AAGTGGGTAAGGAGAGATGGAGG - Intronic
953470750 3:43163949-43163971 GTGTGGGTAGCAGGAGGTGAGGG + Intergenic
953637303 3:44674079-44674101 GTGTGGGGAGGGACACATGCAGG - Intergenic
953700272 3:45190295-45190317 GTGGGCGGAGGGAGAGATGTCGG + Intergenic
954573548 3:51662372-51662394 GAGTGGCCAGGGAGAGAAGAAGG - Intronic
954794417 3:53154288-53154310 GTGTGGGTGGGGTGGGAGGAGGG + Intergenic
954909269 3:54088954-54088976 TTGTGGGGAGGGAAAGATAAGGG - Intergenic
955326098 3:58010136-58010158 GTGTGGGTTGGGGCAGAGGAGGG + Intronic
955532694 3:59890875-59890897 GTGTTGGGGGGGAGAAATGAAGG - Intronic
956411081 3:68980495-68980517 GTGAGGCTAGGGAGAAATGCTGG + Intronic
956538827 3:70310689-70310711 TTGGGGGTAGGGTGAGATTAAGG + Intergenic
956651986 3:71512771-71512793 CTGTGTGTGGGAAGAGATGACGG - Intronic
956744182 3:72298568-72298590 TTGTGGGGAGAGAGTGATGAGGG + Intergenic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
957167353 3:76692039-76692061 TTGAAGGTTGGGAGAGATGAAGG + Intronic
957276369 3:78095328-78095350 GTGGGGGTGGGGAGAGGTGCAGG - Intergenic
957313937 3:78553367-78553389 AAGTGGGTAGGTAGATATGATGG + Intergenic
958537168 3:95418558-95418580 GTGTGGGTAGGGAGGGAACCCGG + Intergenic
959740614 3:109714942-109714964 GTGAGGGTAGTTAGTGATGATGG - Intergenic
960089457 3:113624677-113624699 GTGGGGGGAGAGGGAGATGAGGG - Intronic
960684212 3:120280698-120280720 GTGTGAGTAAGGAGAGAAGGTGG - Intronic
961479757 3:127172123-127172145 GTATGGGGAGGGAGAGCAGAGGG + Intergenic
961999939 3:131285282-131285304 GAGTGGGTAGAGAGAGAAGGTGG + Intronic
962299846 3:134229651-134229673 CTGGGGGAAGGGAGAGATGTTGG + Intronic
962413151 3:135159080-135159102 GGGTGGGGAAGGAGAAATGAGGG + Intronic
963456273 3:145551710-145551732 GGGTTGGTATGGAGAGATAATGG + Intergenic
963466921 3:145693825-145693847 GTGAGGGTAGGAGGAGATAAAGG - Intergenic
963522062 3:146367469-146367491 GGTTGGGTATGGAGAGATAATGG - Intergenic
963550097 3:146709380-146709402 GTATGGGAAGGGAGGGAGGAAGG - Intergenic
964299736 3:155274915-155274937 GGGTTGGTATGGAGAGATAATGG + Intergenic
964928838 3:161990676-161990698 CTGTGGGAAGGGACAGATAAAGG - Intergenic
965560524 3:170057850-170057872 GCCTGGGAAGGGAGAGAGGAGGG + Intronic
965651919 3:170943131-170943153 AAGCGGGCAGGGAGAGATGAGGG - Intergenic
965659338 3:171024427-171024449 GTGTGGGAACCGAGAGCTGATGG + Intronic
966547900 3:181171357-181171379 CTGTGGGTAGGAAGAAAGGAAGG + Intergenic
966603813 3:181801698-181801720 GAGTGGGGAGGGAGGGAGGAAGG + Intergenic
966631059 3:182075565-182075587 ATGGGGGTTGGGGGAGATGAAGG - Intergenic
966770600 3:183500350-183500372 GTGTGGCCAGGGAGGGAGGAAGG + Intronic
966963409 3:184965176-184965198 GTGTGGCTAGGAATAGATTAGGG + Intronic
967048908 3:185763976-185763998 GTGAGGGCAGAGAGAGAAGAGGG + Intronic
967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG + Intronic
968267659 3:197375209-197375231 GTGGGGATGGGGAGAGAGGATGG - Intergenic
968399937 4:285314-285336 GTGTGTGCAGGGAGATAAGATGG + Intronic
968595420 4:1479753-1479775 GTGTGGGCAGAGAGCCATGAGGG + Intergenic
968690544 4:1987701-1987723 GTGTGGGCACGGAGACAGGAGGG - Intronic
968719631 4:2191681-2191703 TTGGGGGTGGGGAGAGATGATGG + Intronic
968983411 4:3863053-3863075 GGGTGGGGAGGGAGAGATGGGGG + Intergenic
969583386 4:8078326-8078348 GTGTGCGTGGGGAGAGGGGATGG - Intronic
970735585 4:19163606-19163628 GGGAGGGTGGGAAGAGATGAAGG - Intergenic
971460449 4:26890249-26890271 GTGTGGGCTGGGAGAGAGAAGGG + Intronic
971564087 4:28116818-28116840 ATGTGGGTAGGGCCAGATAAGGG - Intergenic
972457486 4:39268925-39268947 GTTGGGGTAGGGAGAGTTGGAGG + Intronic
973189684 4:47372898-47372920 GTATGGGGAGGGAGTGAGGAGGG - Intronic
973652324 4:53008335-53008357 GGGTGGGGAGGGAGAGGGGAAGG - Intronic
973741727 4:53925400-53925422 GTGTGGGTGGGGACAGAGGTGGG - Intronic
974525055 4:63040434-63040456 GTGAGGGAAGGAAGAGAGGAAGG - Intergenic
974920687 4:68235475-68235497 GTGGTGGTAGGGAGGGATGCAGG - Intronic
975379464 4:73681542-73681564 GTGGGGGTAGGGGGAGATGTTGG + Intergenic
975997111 4:80328497-80328519 GTGTGGGTAGGTAGGGGTGGGGG + Intronic
976047526 4:80968855-80968877 GTGGGGGGAAGGAGAGAAGAGGG - Intergenic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976466245 4:85372039-85372061 GAGTGGGGAGGGAGGGTTGAAGG + Intergenic
976596937 4:86903705-86903727 ATGTGGGTAGGGTCAGATAAGGG - Intronic
976806068 4:89048457-89048479 GTGGGGGTGGGGAGGGATGGTGG + Intronic
977370247 4:96126109-96126131 ATGTGGGTGGGGCCAGATGAGGG - Intergenic
977731015 4:100352305-100352327 GAGTGTGTAGGGTGAGAGGAGGG + Intergenic
978436645 4:108692795-108692817 CTGTGGATAGGGTGAGATCAAGG - Intergenic
979382078 4:120019084-120019106 GTCTGGGCAGGGAGATGTGAAGG - Intergenic
979474463 4:121138850-121138872 GAGGGGGTAGGGAGAGATGATGG - Intronic
979499102 4:121418648-121418670 GTGTCGGGAGGAAGAGGTGATGG + Intergenic
979972141 4:127148642-127148664 GTGTCAGTAGGGAATGATGATGG - Intergenic
980145133 4:128973423-128973445 GTGGGGGGAGGGAGAGGGGAGGG + Intronic
980971630 4:139572743-139572765 GGGAGGGTAGAGAGAGAGGAAGG - Intronic
981342496 4:143637906-143637928 TGGTGGGTGGGGAGAGAAGAAGG + Intronic
981362402 4:143862865-143862887 GGTTGGGTAGAGAGAGAAGATGG + Intergenic
981373132 4:143983633-143983655 GGTTGGGTAGAGAGAGAAGATGG + Intergenic
981382227 4:144086908-144086930 GGTTGGGTAGAGAGAGAAGATGG + Intergenic
982343862 4:154334213-154334235 TTGAGGGAAGGGAGAGAGGAAGG + Intronic
982802266 4:159720010-159720032 GTGTGGCTACGGAGTGAGGATGG + Intergenic
982902579 4:161025847-161025869 TTGTGGGAAGGGAGACATGGGGG - Intergenic
983336100 4:166394549-166394571 GAGGGGGAAGGGAGAGAAGAGGG + Intergenic
984556927 4:181225686-181225708 GTGTGGGGAGTGAGAAAAGAAGG - Intergenic
985100990 4:186458486-186458508 GTGGGGGGAGGGAGGGACGAGGG - Intronic
985331195 4:188837208-188837230 GTGTGGGAAGGAAGCGGTGATGG + Intergenic
985367954 4:189253397-189253419 GAGTGGGTAGGGTGGGAGGAGGG + Intergenic
985843490 5:2327171-2327193 GGGTGGGTAGGGGCAGCTGATGG + Intergenic
985907780 5:2854438-2854460 ATGTGGGCAGGGAGAAATAAGGG - Intergenic
986154786 5:5164001-5164023 GTGTGGGTGGGGTGTGATAAAGG - Intronic
986631861 5:9781836-9781858 GTGAGGATAGGCAGGGATGATGG - Intergenic
987066610 5:14296117-14296139 GTGTGGGAAGTGAGAGAAGGGGG + Intronic
987198620 5:15552368-15552390 GTTTGTCAAGGGAGAGATGATGG - Intronic
987696734 5:21342104-21342126 ATGTGGGTGGGGTGAGATAAGGG + Intergenic
988020407 5:25614144-25614166 ATGTGGGTAGGGCCAGATAAAGG - Intergenic
988358395 5:30204890-30204912 ATGTGGGCAGGGACAAATGAGGG + Intergenic
988407951 5:30848872-30848894 GTGGGGATAGTGAGAGATCACGG + Intergenic
988755473 5:34244442-34244464 ATGTGGGTGGGGTGAGATAAGGG - Intergenic
989306058 5:39957242-39957264 GTGGGGGTGGGGAGAGAGAAAGG + Intergenic
990182309 5:53174594-53174616 GTGTGGGAAGGGAGGGAGGGAGG - Intergenic
990540584 5:56768871-56768893 TTCTGGGTAGGGAGAGCTGGAGG - Intergenic
990729474 5:58792590-58792612 GTGAGGGAGGGGGGAGATGAAGG + Intronic
991743705 5:69710170-69710192 ATGTGGGTGGGGTGAGATAAGGG - Intergenic
991754003 5:69845065-69845087 ATGTGGGTGGGGTGAGATAAGGG + Intergenic
991795278 5:70289902-70289924 ATGTGGGTGGGGTGAGATAAGGG - Intergenic
991803628 5:70401820-70401842 ATGTGGGTGGGGTGAGATAAGGG + Intergenic
991823077 5:70585445-70585467 ATGTGGGTGGGGTGAGATAAGGG - Intergenic
991833320 5:70720185-70720207 ATGTGGGTGGGGTGAGATAAGGG + Intergenic
991887644 5:71289421-71289443 ATGTGGGTGGGGTGAGATAAGGG - Intergenic
992093365 5:73339064-73339086 GTGTGGTGGAGGAGAGATGATGG + Intergenic
992322604 5:75628723-75628745 ATTTGGGTGGGGAGAGATGGAGG + Intronic
992404612 5:76445221-76445243 GAGTGGTTAGGGAAAGGTGATGG + Intronic
992718426 5:79534447-79534469 GTGTGGCTGGGGAGTGATGCAGG - Intergenic
993504539 5:88693782-88693804 GAGAAGGTAGAGAGAGATGAGGG + Intergenic
993833663 5:92789821-92789843 GTGTGTGAAGGGTGAGAGGAGGG - Intergenic
994717183 5:103335709-103335731 TTCCGGGTAGGGAGAGAGGATGG + Intergenic
995388198 5:111611627-111611649 GTGTGGGTGGGGCCAGATAAGGG - Intergenic
995415542 5:111908421-111908443 GAGTGGGGAGGAAGAGATGTGGG - Intronic
995949919 5:117699165-117699187 GAGTGGGAAATGAGAGATGAGGG - Intergenic
996103489 5:119470292-119470314 GTGTGGGCATGGTGGGATGATGG + Intronic
996544469 5:124663268-124663290 GTTTGGGTAAGAAGAGATAATGG - Intronic
997163296 5:131632206-131632228 GTGAGAGTAGTAAGAGATGAAGG - Intronic
997798801 5:136839149-136839171 GTGTGGTTAGGGAGAAATGGAGG - Intergenic
998013602 5:138714947-138714969 GAGAGGGCAGGGAGAGAGGAGGG + Intronic
998535928 5:142930659-142930681 GTGTGGGTCGGGAGAGACAGAGG - Intronic
998633331 5:143925445-143925467 GGGGTGGTAGGGAGAGATAATGG + Intergenic
999242074 5:150133530-150133552 GTGAGGGTGGGGAGCGTTGAAGG + Intronic
999361506 5:150990040-150990062 GTGTTGGAAGGGGGAGAAGAGGG + Intergenic
999719565 5:154388929-154388951 GAGTGGGGAGGGAGAGAGGGAGG + Intronic
1000809931 5:165848641-165848663 GGGTGAGGAGGAAGAGATGAGGG - Intergenic
1001678065 5:173534924-173534946 GTGTGGGTGGGGACACATGGGGG - Intergenic
1002179806 5:177425552-177425574 GTGAGGGCAGGGTGAGATAAAGG - Intronic
1002473258 5:179450135-179450157 CTGTGGGAAGGAATAGATGAGGG + Intergenic
1002480964 5:179500518-179500540 CTGTGGGAAGGAATAGATGAGGG - Intergenic
1002736436 5:181391388-181391410 GTGGGGGTTGGGAGAGGTGGGGG - Intergenic
1002748261 6:83436-83458 GTGGGGGTTGGGAGAGGTGGGGG + Intergenic
1003145251 6:3504876-3504898 GTGGGGGTTGGGAGAGGGGAGGG + Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003822176 6:9910915-9910937 GTGGGGGTAGGTGGTGATGATGG - Intronic
1003891087 6:10564407-10564429 ATGAGGGTAGGGAGAGCTAAGGG - Intronic
1004256507 6:14069286-14069308 GAGTGGGGAGAGAGAGAGGACGG + Intergenic
1005164796 6:22907375-22907397 GTGTGTGTAGGGAGTGAGGATGG - Intergenic
1005387918 6:25304272-25304294 GTGAGGGTGGGGATAGAGGATGG + Intronic
1005554105 6:26956214-26956236 ATGTGGGTGGGGTGAGATAAGGG - Intergenic
1006425573 6:33960879-33960901 ATGTGGGGAGGGAGACAGGAGGG - Intergenic
1007418734 6:41706810-41706832 GTGTGGGCGGGGGGAGATGGGGG - Intronic
1007910961 6:45513652-45513674 GGGTGAGTAGGGAAAGAAGAGGG + Intronic
1008527064 6:52417932-52417954 GAGTGGGTAGGGAGGGATCATGG + Intergenic
1009751234 6:67881507-67881529 GGGATGGTATGGAGAGATGATGG + Intergenic
1010274479 6:73953210-73953232 ATATGGGAGGGGAGAGATGATGG + Intergenic
1010467166 6:76181706-76181728 GAGTGGGGAGGGTGAGAGGAGGG + Intergenic
1010706420 6:79117162-79117184 GTGAGGGTTGGGAGAGGTGGGGG + Intergenic
1011446185 6:87443766-87443788 GAGTGGGGAGAGAGAGAGGAGGG - Intronic
1011629497 6:89310492-89310514 GAGAGGGTAGAGAGAGAAGATGG - Intronic
1012145159 6:95670968-95670990 GTGTGGGTGGGGACAGATAAGGG + Intergenic
1012276849 6:97284468-97284490 GTGTGTGCAGAGAGAGAGGAGGG - Intergenic
1013279491 6:108622379-108622401 GGGTGGGCAGGGAGAGAGAAGGG + Intronic
1013580582 6:111530297-111530319 GAGTGGGGAGGGAGAGAGGGAGG - Intergenic
1014008620 6:116450771-116450793 GTGTGGGTATGGAAAGATAGTGG + Intergenic
1014263055 6:119241865-119241887 CTGGGGGAAGGGAAAGATGAAGG + Intronic
1015507740 6:134007005-134007027 ATGAGGGCAGGGAGAGATCAGGG - Intronic
1015585092 6:134768432-134768454 GTGTGGGAAAGATGAGATGATGG - Intergenic
1015851811 6:137581909-137581931 GTGAGAGCAGGGAAAGATGAAGG + Intergenic
1015891759 6:137976785-137976807 GTGTGTGTAGGGAGGCAGGATGG - Intergenic
1016677277 6:146785921-146785943 GTGTGTGAAGGGGGAGATGTAGG - Intronic
1017027207 6:150191918-150191940 GTGTAGATAGGGAAAGAAGAGGG + Intronic
1017668639 6:156747819-156747841 GTGAGATTAGGGAGAGAGGAAGG - Intergenic
1017685778 6:156912851-156912873 GTTTGGGGTGGGAGAAATGATGG - Intronic
1018057676 6:160066588-160066610 GGTTGGGGAGGGAGAGGTGAGGG - Intronic
1018082615 6:160271330-160271352 GAACGGGAAGGGAGAGATGAGGG + Intronic
1018904494 6:168067225-168067247 GCGTGGGTTGGGAGAGAGCAGGG - Intronic
1019026836 6:168972910-168972932 GTGTGTGTATGGAGAGAGAAAGG - Intergenic
1019190722 6:170249192-170249214 GTGTGTGTAGTTAAAGATGAGGG - Intergenic
1019241534 6:170666917-170666939 GTGGGGGTTGGGAGAGGTGGGGG - Intergenic
1019533551 7:1515804-1515826 GCGTGGGCTGGGAGAGCTGAAGG + Intergenic
1020224160 7:6266717-6266739 GTGTGGGATGGGAGAGGTGTAGG - Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020820671 7:12963585-12963607 GTGTGGGTGGGGCAAGGTGAGGG - Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021556088 7:21919656-21919678 GTGAGATGAGGGAGAGATGAGGG - Intronic
1021951940 7:25783562-25783584 GTGTGTGTATGGGGAGATGGCGG - Intergenic
1022393014 7:29959951-29959973 GTGGGGGGAGGGAGGGAGGAGGG + Intronic
1022396472 7:29991470-29991492 GTGTGGGTAGGGAGAGCATTAGG + Intergenic
1022527844 7:31049838-31049860 GGGTGGGGAGGCAGAGAAGAGGG + Intergenic
1022548893 7:31217651-31217673 CTGAGGAGAGGGAGAGATGAGGG + Intergenic
1022908195 7:34876062-34876084 GGTGGGGCAGGGAGAGATGAAGG + Intronic
1022935942 7:35176556-35176578 ATGTGGGCAAAGAGAGATGAAGG + Intergenic
1023044808 7:36201715-36201737 GTGAGGGTTGGCAGAGATAAGGG - Intronic
1023167088 7:37353670-37353692 GTGTGGGTGGGGCCAGATAAGGG - Intronic
1023450931 7:40284150-40284172 GTGGGGGCAGGGGAAGATGATGG + Intronic
1023598346 7:41855933-41855955 GTGGGGGCAGGCAGGGATGAAGG - Intergenic
1024121136 7:46241979-46242001 GAGTGGGGAGGGTGAGAGGAAGG - Intergenic
1025611739 7:63080648-63080670 GTCTGGGGAGCAAGAGATGAGGG + Intergenic
1026282594 7:68934968-68934990 GTGTGAGAAGTGAGAGATGAAGG - Intergenic
1028449628 7:90966669-90966691 GTGTGTTTAGGATGAGATGAGGG + Intronic
1028454722 7:91026637-91026659 GTGAGGGAGGGGAGAGACGATGG - Intronic
1028567918 7:92253327-92253349 GTGTTAGTAGGGGTAGATGAAGG - Intronic
1028705582 7:93841189-93841211 GTGGGAGTAGGGAGAGGAGAGGG - Intronic
1028851522 7:95543339-95543361 GTGTAGGTAGGGAGCCAGGAAGG - Intergenic
1030082716 7:105791293-105791315 GTGGCAGTAGGGAGAGATGAGGG - Intronic
1030104188 7:105973055-105973077 GAGTGGGTAGGGACAGTAGAAGG - Intronic
1030287338 7:107840048-107840070 GTATGGGGAGGGGAAGATGATGG + Intergenic
1030722610 7:112886764-112886786 GTGGGGGCAGGGAGATATGGTGG - Intronic
1030964233 7:115969768-115969790 GTGGCTGTAGGGAGAGATGATGG + Intronic
1031028517 7:116709175-116709197 GTGTCTGTAGGTAAAGATGAAGG - Intronic
1031742147 7:125446995-125447017 GTGCGAATAGGGAGGGATGAGGG - Intergenic
1032250849 7:130256160-130256182 GGGTGGGTAGTGATAGATGTAGG - Intergenic
1032625157 7:133583975-133583997 GTGTGGGTCGGGGAAGAAGAAGG + Intronic
1032935523 7:136726830-136726852 TTGTGTGTAGTGAGAGATGTGGG - Intergenic
1033639558 7:143248334-143248356 ATGGGTGTAGGGAAAGATGAAGG - Intronic
1033825416 7:145184017-145184039 GTGTGACTCCGGAGAGATGAGGG + Intergenic
1034297831 7:149990058-149990080 GTGTGGGGAGGGATGGATGAAGG - Intergenic
1034426259 7:151015843-151015865 GTGAGGGGAGGGAGAAAGGACGG - Intronic
1034554544 7:151841637-151841659 GTGATGGTAGGTAGTGATGATGG + Intronic
1034554559 7:151841715-151841737 GTGATGGTAGGTAGTGATGATGG + Intronic
1034554564 7:151841762-151841784 GTGATGGTAGGTAGTGATGATGG + Intronic
1034554580 7:151841885-151841907 GTGATGGTAGGTAGTGATGATGG + Intronic
1034554611 7:151842064-151842086 GTGATGGTAGGTAGTGATGATGG + Intronic
1034554632 7:151842164-151842186 GTGATGGTAGGTAGTGATGATGG + Intronic
1034554640 7:151842211-151842233 GTGATGGTAGGTAGTGATGATGG + Intronic
1034554648 7:151842258-151842280 GTGATGGTAGGTAGTGATGATGG + Intronic
1034554661 7:151842323-151842345 GTGATGGTAGGTAGTGATGATGG + Intronic
1034554693 7:151842458-151842480 GTGATGGTAGGTAGTGATGATGG + Intronic
1034554704 7:151842514-151842536 GTGATGGTAGGTAGTGATGATGG + Intronic
1034554718 7:151842605-151842627 GTGATGGTAGGTAGTGATGATGG + Intronic
1034554726 7:151842657-151842679 GTGAGGGTAGGTAGTGATGATGG + Intronic
1034554731 7:151842682-151842704 GTGATGGTAGGTAGGGATGATGG + Intronic
1034808192 7:154106795-154106817 ATGTGGGGAGGGACGGATGAAGG + Intronic
1034896897 7:154881962-154881984 ATGAGGGTGGGGAGAGGTGATGG - Intronic
1035056649 7:156040499-156040521 GTATGGGTGGGGTGAGATGCGGG + Intergenic
1035506582 8:141179-141201 GTGGGGGTTGGGAGAGGTGGGGG + Intergenic
1035922310 8:3690981-3691003 GTGAGGGTGGGGAGTGCTGACGG + Intronic
1035937077 8:3852705-3852727 GTGAGGGACGGGAGAGATGGAGG + Intronic
1036470402 8:9047726-9047748 GAGAGGGGAGGGAGAGATGCAGG - Intronic
1037239374 8:16760016-16760038 ATGTGGGTGGGGCCAGATGAGGG - Intergenic
1037249012 8:16871112-16871134 ATGAGGCTAGGGAGAGAGGAAGG + Intergenic
1037822211 8:22140495-22140517 GAGTGGGGAGGGAGAGAGAATGG - Intronic
1037891816 8:22627654-22627676 AGGTGGGCAGGGAGAGAGGAGGG - Intronic
1037912905 8:22754769-22754791 GTGAGGGAGGGGAGAGATGTGGG - Intronic
1038240528 8:25803682-25803704 GAGCAGGTAGGGAGGGATGAGGG + Intergenic
1038350435 8:26771466-26771488 GTTTGGGTAGGTAGAGAAGGTGG - Intronic
1039734957 8:40321936-40321958 GGGTGGATAGGAAGAGAAGAGGG - Intergenic
1039824085 8:41158154-41158176 ATGTGACTAGGAAGAGATGAAGG - Intergenic
1039898842 8:41735951-41735973 GTGTGTGTAGGGAGAGGGGGTGG + Intronic
1040772872 8:51000206-51000228 AAGTGGGTATGGAGAGATAAAGG - Intergenic
1040869278 8:52083622-52083644 AAGTTGGTAGGGAGGGATGATGG + Intergenic
1040964471 8:53070722-53070744 ATGTGGGTGGGGTGAGATAAGGG - Intergenic
1041212146 8:55563371-55563393 GTGTAGGTAAGGTGAGAGGAGGG + Intergenic
1041302387 8:56426365-56426387 GAGTGTGAAGGGAGAGAGGAGGG - Intergenic
1041304815 8:56447513-56447535 TGGTGGGGAGGGAGGGATGAGGG + Intergenic
1041698612 8:60763453-60763475 GTGTGGGTGGGGAGCGGTCAGGG + Intronic
1042040349 8:64582131-64582153 GGGTGGGGAGGGAGGGAGGAGGG + Exonic
1042507033 8:69571925-69571947 CTCTGGGTAGAGACAGATGACGG - Intronic
1043148917 8:76688386-76688408 GGCTGGGAAGGGAGAGAAGAGGG + Intronic
1043377233 8:79664299-79664321 GTGTGTGTAGGAAAAGATGGGGG + Intronic
1043403503 8:79906914-79906936 TTGTGGGGTGGTAGAGATGAGGG + Intergenic
1043725857 8:83610555-83610577 GTGTGGGTGGGGTCAGATAAGGG - Intergenic
1044488527 8:92783381-92783403 CTGTGTGTAAGGAGAGCTGACGG + Intergenic
1045430318 8:102107927-102107949 GTGTGGGTGGGGTGAGGGGAAGG - Intronic
1046055149 8:109070618-109070640 ATGTGGGTAGGGTCAGATAACGG - Intergenic
1046090320 8:109495859-109495881 GTGTGGGGAGGGAGTTATTAAGG + Intronic
1046681809 8:117178889-117178911 GTGGGGGAAGAGAGAGAAGAAGG + Intergenic
1046873024 8:119224686-119224708 GAGTGGGTGGGGAGAGGAGAAGG - Intronic
1048065115 8:130959861-130959883 GTGAGGGTATGGAGACATGCTGG + Intronic
1048209567 8:132443547-132443569 GTGTGGGTAGTGGGGGATGATGG - Intronic
1048282014 8:133112592-133112614 GTGAGGGAAGGGAGAGAAAAGGG + Intronic
1049047994 8:140168056-140168078 GTTTGGGGAGTGGGAGATGATGG - Intronic
1049083665 8:140461337-140461359 GCATGGGTAGGGTGTGATGAAGG + Intergenic
1049272246 8:141702221-141702243 GTGTGTGTTGGGGGAGATGGGGG + Intergenic
1049426167 8:142538787-142538809 GTCTGGGGAGGGAGAGGTGGTGG - Intronic
1050313353 9:4375342-4375364 GTGTGGGTACAGAGAGAAAAGGG + Intergenic
1050837047 9:10095827-10095849 GTCTGGGTAGATAGAGATAATGG - Intronic
1051130065 9:13850856-13850878 GTGGGGGCAGGCAGAGAAGAAGG - Intergenic
1051161144 9:14208900-14208922 GTGTTGCAAGGAAGAGATGAGGG - Intronic
1051424978 9:16923947-16923969 ATGTGGGTAGGGTCAGATAAGGG - Intergenic
1051549678 9:18315075-18315097 ATGTGGGTAGGGTCAGATAAGGG - Intergenic
1051968793 9:22862825-22862847 ATGTGGGTAGGGCCAGATAAGGG - Intergenic
1051972045 9:22900249-22900271 GTGTGGGAAAAGAGAAATGAAGG - Intergenic
1052122930 9:24739420-24739442 ATGTGGGTGGGGTGAGATAAGGG + Intergenic
1052148400 9:25079156-25079178 GTGGGTGTAAGGGGAGATGAAGG - Intergenic
1053329189 9:37188548-37188570 GGGAGGGTAGGGGGAGGTGAGGG - Intronic
1054375192 9:64444254-64444276 GTGGGGGTGGGGAGAGTTGGGGG + Intergenic
1055430327 9:76237038-76237060 GTGTAGGTAGGAAGATTTGAGGG - Intronic
1056039531 9:82648339-82648361 GTGTGTGTAGAGAGAGAGGGAGG + Intergenic
1056084642 9:83134173-83134195 GAGTAGGGAGGGAGAGAAGAGGG - Intergenic
1056120433 9:83482712-83482734 ATGTGCCAAGGGAGAGATGATGG + Intronic
1057028747 9:91757229-91757251 GTGTGGGTTAGCAGATATGAAGG - Intronic
1057565084 9:96160213-96160235 GGGAGGGAAGGGAGAGAAGAAGG + Intergenic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1059114087 9:111585330-111585352 GTGTGGGGTAGGAGAGGTGAAGG - Intronic
1059139900 9:111843115-111843137 GTGGGGGTAGGGAGATAGAAAGG + Intergenic
1059700076 9:116767339-116767361 GGGTGGCTTGGGAGAGACGAGGG + Intronic
1060025605 9:120168228-120168250 GGGTGGGTATGCAGAGAAGAGGG - Intergenic
1060147520 9:121265644-121265666 GTGAGGCTGGGGAGAAATGAAGG - Intronic
1060240141 9:121896428-121896450 GTGTGAGATGGGAGAGCTGAGGG - Intronic
1060428942 9:123531540-123531562 GTGTGTGTAGAGAGAGAGGGGGG - Intronic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1060826756 9:126692155-126692177 GGATGGGTAGGGACAGATGGTGG - Intronic
1060919268 9:127409006-127409028 GGGGAGGTAGGGAGAGATGACGG + Intergenic
1060919284 9:127409052-127409074 GGGGAGGTAGGGGGAGATGATGG + Intergenic
1060919356 9:127409239-127409261 GGGGAGGTAGGGGGAGATGATGG + Intergenic
1061079327 9:128360771-128360793 GTGAGGGTAGGGAGAGGACAAGG + Exonic
1061275565 9:129568087-129568109 GAGTGGGGAGGGACAGAGGAAGG - Intergenic
1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG + Intronic
1061391540 9:130319718-130319740 GGGTGGGCAGGGAGACAGGATGG + Intronic
1061405783 9:130392306-130392328 GTGGGGGTAGGAGGAGATGCAGG + Intronic
1061623513 9:131826722-131826744 TTGTGTGTAGGGAGGGATGGGGG - Intergenic
1061874214 9:133535850-133535872 GAGGGGGTGGGGAGAGCTGAGGG + Intronic
1062273543 9:135720508-135720530 GAGGGGATAGGAAGAGATGATGG - Intronic
1062445162 9:136590592-136590614 CTATGGGGAGGCAGAGATGATGG - Intergenic
1062460032 9:136659182-136659204 GTTTGGGCAGGGAGAAGTGAGGG - Exonic
1062518925 9:136949687-136949709 CTGTGGGGAGGCCGAGATGAAGG + Intronic
1062539422 9:137035025-137035047 GCCTGGGTGGGGTGAGATGAGGG - Exonic
1062580671 9:137227956-137227978 GTGGGGGAGGGGAGAGGTGAGGG + Intronic
1203601726 Un_KI270748v1:16151-16173 GTGGGGGTTGGGAGAGGTGGGGG - Intergenic
1185459479 X:328220-328242 GGGGGGGCAGGGAGAGAGGAGGG - Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186137024 X:6532789-6532811 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137045 X:6532848-6532870 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137056 X:6532878-6532900 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137068 X:6532911-6532933 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137087 X:6532970-6532992 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137106 X:6533029-6533051 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137118 X:6533062-6533084 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137129 X:6533092-6533114 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137141 X:6533125-6533147 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137152 X:6533155-6533177 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137164 X:6533188-6533210 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137176 X:6533221-6533243 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137187 X:6533251-6533273 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137198 X:6533281-6533303 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137218 X:6533343-6533365 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137240 X:6533405-6533427 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137252 X:6533438-6533460 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137263 X:6533468-6533490 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137275 X:6533501-6533523 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137287 X:6533534-6533556 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186267155 X:7844205-7844227 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267177 X:7844267-7844289 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267199 X:7844329-7844351 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267211 X:7844362-7844384 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267222 X:7844392-7844414 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267234 X:7844425-7844447 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267245 X:7844455-7844477 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186297738 X:8169171-8169193 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297750 X:8169204-8169226 GTGTGGGGAGGGAGGGAGGGGGG - Intergenic
1186297764 X:8169237-8169259 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297776 X:8169270-8169292 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297788 X:8169303-8169325 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297800 X:8169336-8169358 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297812 X:8169369-8169391 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297824 X:8169402-8169424 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297836 X:8169435-8169457 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297858 X:8169497-8169519 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297870 X:8169530-8169552 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297882 X:8169563-8169585 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297904 X:8169625-8169647 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297926 X:8169687-8169709 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297940 X:8169724-8169746 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297952 X:8169757-8169779 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297964 X:8169790-8169812 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297978 X:8169827-8169849 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186324882 X:8466630-8466652 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324955 X:8466838-8466860 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324967 X:8466871-8466893 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324978 X:8466901-8466923 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324989 X:8466931-8466953 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325001 X:8466964-8466986 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325014 X:8466997-8467019 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325036 X:8467059-8467081 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325117 X:8467296-8467318 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186672280 X:11780040-11780062 GTGTGTGTGTGTAGAGATGAGGG - Intergenic
1187311145 X:18144207-18144229 CTGTGAGGAGGGAGACATGAGGG - Intergenic
1187949785 X:24460490-24460512 GTGGGGGGAGGGAGAGAGGTAGG + Intergenic
1188734578 X:33696705-33696727 ATGAGGGGAGGGAGAGAAGAAGG + Intergenic
1189279617 X:39812023-39812045 GTGTGGGTAGGGGGAGGTGGGGG - Intergenic
1189726061 X:43969325-43969347 GTTTGGGGAGGGAGGGATGTGGG + Intronic
1189732359 X:44034458-44034480 GTGTTGGTGGGGAGAGAAGAGGG - Intergenic
1189749389 X:44203908-44203930 GTGGTGGCAGGAAGAGATGATGG - Intronic
1190157939 X:48008680-48008702 GTCTGGGTAGGGGTAGAGGATGG - Intronic
1190173710 X:48131564-48131586 GTCTGGGTAGGGGTAGAGGATGG - Intronic
1190382822 X:49855991-49856013 GAGTGGGGAGTGGGAGATGAGGG - Intergenic
1192229800 X:69257045-69257067 GGATGGGTAGGCAGAGGTGAAGG - Intergenic
1192534661 X:71917242-71917264 GAGGGGGGAGGGAGAGAGGAAGG - Intergenic
1193444736 X:81586628-81586650 GTGTGGGTTGGGGGTGGTGAGGG + Intergenic
1193741784 X:85225943-85225965 GTTGGGGGAGAGAGAGATGAGGG - Intergenic
1194673394 X:96764383-96764405 GTGTGTGGAGGCAGAGAAGAAGG + Intronic
1195814403 X:108869314-108869336 GAGTTGGCAGGGAGAGATGGGGG + Intergenic
1196119206 X:112030389-112030411 GTGTGGGTTGAGAAAGATGTTGG - Intronic
1196440139 X:115712006-115712028 TTGGGGGCAGGGAGAGATAAGGG - Intergenic
1196743792 X:119049776-119049798 CTGGGGGTAGGGGGAGATGGTGG + Intergenic
1196745223 X:119065835-119065857 GAGCGGGTGGGGAGAGATGCGGG - Intergenic
1196745366 X:119066977-119066999 GGGTGGGTTAGGAGAGGTGAGGG + Intergenic
1196845844 X:119896359-119896381 GGGTGGGTAGGAAGAGATGGGGG - Intronic
1196916861 X:120545868-120545890 GTGGGGGTGGGGAGGGGTGATGG + Intronic
1196992365 X:121344381-121344403 GGGTTGGTATGGAGAGATAATGG + Intergenic
1197500246 X:127232534-127232556 GGGTTGGTATGGAGAGATAATGG - Intergenic
1197637498 X:128931388-128931410 GTGTGGTCAGGGAGAGCTGCAGG - Intergenic
1197650530 X:129058901-129058923 GATTGGATAGGTAGAGATGAAGG - Intergenic
1197825808 X:130589137-130589159 GTGGGGGTGGGGAGAGCAGAAGG - Intergenic
1197830716 X:130639323-130639345 GTGTGGGTGGGGGGTGATGGTGG + Intronic
1198034033 X:132783524-132783546 GTGTGGGTGGGTAGAGATGAAGG - Intronic
1198146171 X:133859517-133859539 GTGTGGGTAGGGAGAGATGAAGG + Intronic
1198546966 X:137702399-137702421 GTGTGGGGAGCTAGAGAAGAGGG - Intergenic
1198566961 X:137914854-137914876 ATGTGGGTAGGGTGAGGGGAGGG + Intergenic
1199288368 X:146078563-146078585 GAGTGGGTAGGGAGAGAATAGGG + Intergenic
1199824021 X:151479540-151479562 GTCTGGGTGGTAAGAGATGAAGG + Intergenic
1199963745 X:152801038-152801060 GTGTGGGAAGGGAGGGAGGTGGG - Intergenic
1200014426 X:153147653-153147675 GTGTTGGTCGGGAGAGCTGTAGG - Intergenic
1200025176 X:153252301-153252323 GTGTTGGTCGGGAGAGCTGTAGG + Intergenic
1200070419 X:153526315-153526337 GGGAGGGTAGGGGGAGCTGATGG + Intronic
1201292584 Y:12435847-12435869 TTGTGGGTACGGAAAAATGATGG - Intergenic