ID: 1198147232

View in Genome Browser
Species Human (GRCh38)
Location X:133869514-133869536
Sequence AGGACTACTGACACAAACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198147229_1198147232 23 Left 1198147229 X:133869468-133869490 CCTGTTGGGGTTCAGTGAGCACA 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1198147232 X:133869514-133869536 AGGACTACTGACACAAACCATGG 0: 1
1: 0
2: 2
3: 12
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198147232 Original CRISPR AGGACTACTGACACAAACCA TGG Intronic
902541809 1:17161136-17161158 GGGATAACTGATACAAACCAAGG - Intergenic
903156717 1:21449739-21449761 AGGATTACAGACATGAACCACGG + Intronic
903237752 1:21961423-21961445 AGGACTCCAGACGCAAGCCAGGG - Intergenic
907585632 1:55615451-55615473 AGGCATACTGTCACAAGCCAAGG + Intergenic
908734423 1:67261168-67261190 AGGACAATGGACAGAAACCAGGG - Intergenic
910034126 1:82769741-82769763 AGAACCACTGGCACAACCCATGG + Intergenic
910357305 1:86374778-86374800 AGGACTACAGAGACAGATCAAGG - Intronic
913601382 1:120424716-120424738 AGGATTACAGACACGAGCCACGG + Intergenic
914191558 1:145415858-145415880 AGGATTACAGACACGAGCCACGG - Intergenic
914589486 1:149093862-149093884 AGGATTACAGACACGAGCCACGG - Intronic
917045527 1:170855665-170855687 AGAACTACTAAAACATACCACGG - Intergenic
917153981 1:171975840-171975862 AGGATTACAGGCACAAACCGTGG - Intronic
917505553 1:175623894-175623916 AGGTCTCCTGACACAAGTCAAGG + Intronic
920740131 1:208573770-208573792 AGGACTACTGACCCAGAAGAAGG + Intergenic
921359819 1:214320488-214320510 GGGACTACAGACACACGCCATGG - Intronic
922456806 1:225780290-225780312 GGGATTACAGACACAAGCCATGG + Intronic
923746442 1:236704954-236704976 AGGAGTCCTGCCACAAACCTGGG - Intronic
1064420283 10:15184979-15185001 AGGACAACTGGCACACACCGTGG - Intergenic
1066101316 10:32121238-32121260 AGGACCTCTCACACAAACTATGG - Intergenic
1069958393 10:72065466-72065488 AGGAGTACTTACACAGACCTTGG - Intronic
1071585898 10:86820826-86820848 AGGACAAGTAACAAAAACCATGG - Intronic
1071779829 10:88831679-88831701 AGAAAGACTGACACATACCAAGG - Intronic
1072182538 10:93000600-93000622 AGGACTCCAAAGACAAACCACGG + Intronic
1073313135 10:102558587-102558609 TGGACCACTGCCACCAACCAAGG - Intronic
1078078179 11:8180513-8180535 AGGACCACTGACACAGCCCATGG - Intergenic
1080861761 11:36156107-36156129 AGGACTTCTGACACATCGCAAGG - Intronic
1084215044 11:67642529-67642551 AGGACAGAGGACACAAACCATGG + Intergenic
1086630900 11:89018666-89018688 AGGAGGGCTGATACAAACCATGG + Intronic
1087156793 11:94912719-94912741 AGGACTAATTACACATACAAAGG - Intergenic
1087702046 11:101445785-101445807 AGAACTAATGACACAAGCTATGG + Intergenic
1088415642 11:109586157-109586179 AGTACTATTGACACAAAAAAAGG + Intergenic
1094621003 12:32080090-32080112 AGGATTACTGGCATAAGCCATGG + Intergenic
1094622022 12:32088894-32088916 AGGACTCCTCACAGAAAACAAGG - Intergenic
1096160658 12:49374262-49374284 AGGACTGCAGGCACACACCATGG + Intronic
1096692641 12:53330492-53330514 AGGACTACAGGCACACACCAGGG + Intronic
1099848180 12:88056678-88056700 CTGACTACTGGGACAAACCAGGG - Intronic
1100909349 12:99339782-99339804 AGGATTACTGTCAAAAGCCAAGG - Intronic
1103307827 12:119979965-119979987 AGCAATGCTAACACAAACCATGG + Intergenic
1107067138 13:36226577-36226599 GGGACTCCTGATACACACCATGG + Intronic
1109102015 13:58197725-58197747 AGGACTGGTGAGACAAATCAAGG - Intergenic
1111100539 13:83578713-83578735 AGAACTACTTACATAAAACAGGG + Intergenic
1111700909 13:91687329-91687351 ATGATTACTGACACAAATAAAGG - Intronic
1113162693 13:107400382-107400404 AGAACTACTGCCAAAAAGCAAGG - Intronic
1113288900 13:108884092-108884114 AGCACTACTGACAACAACTAAGG - Intronic
1117743894 14:58847783-58847805 GGGACTACAGGCACACACCACGG - Intergenic
1118299446 14:64602145-64602167 GGGACTACAGACACATGCCATGG + Intergenic
1119542013 14:75445443-75445465 AGGACTACAGAGGCAAACCACGG - Intronic
1120542092 14:85763199-85763221 ATGACTCCTGACACAAACAGTGG - Intergenic
1202941097 14_KI270725v1_random:146605-146627 AGGACTCCTGACTCATAACAAGG + Intergenic
1124020675 15:25919814-25919836 AGATCTACTGAAACAAAGCATGG - Intergenic
1125249471 15:37683029-37683051 AGGAGTACTGAAACAAAAGAGGG - Intergenic
1125778350 15:42239588-42239610 AAGAATACTGCCACAAAACATGG + Intronic
1127191612 15:56537204-56537226 GGGACTACAGGCACATACCACGG - Intergenic
1127675822 15:61237856-61237878 AGGACTACTGATACAAATTTGGG + Intergenic
1127677541 15:61256593-61256615 TGGACTACTGACACAGCCAATGG + Intergenic
1128159362 15:65413374-65413396 AGGTCTCCTGACTCAATCCAGGG + Intronic
1128507070 15:68280479-68280501 TGGACTACTGAGAGAAAACAGGG + Intronic
1130158216 15:81371795-81371817 AGACCTACTGAATCAAACCAAGG - Intronic
1131470865 15:92695695-92695717 AGGACCAATGACCCATACCATGG - Intronic
1131812552 15:96187538-96187560 AAGACTACTGACTGAAACCCTGG + Intergenic
1134281415 16:12820293-12820315 AGGACTACAGGCATAAGCCATGG - Intergenic
1134836789 16:17368117-17368139 AGAACTGCCGACACAAACCACGG + Intronic
1135147589 16:19976155-19976177 AGGATTAAGGACACAAACTATGG - Intergenic
1141266034 16:82498205-82498227 AGGACTGCTGACACCAGCCGTGG + Intergenic
1141368651 16:83467028-83467050 AGGACTCCAGCCACAATCCAAGG + Intronic
1141888016 16:86906225-86906247 AGGACAAATGATACAATCCAAGG - Intergenic
1143579949 17:7819586-7819608 AGGGCTACAGACACAAGACAGGG - Intronic
1146700258 17:34952089-34952111 TGGACTACTAAAATAAACCAAGG + Intronic
1147198457 17:38783321-38783343 AGGAGAAGTGACAGAAACCATGG + Intronic
1148572369 17:48680454-48680476 AGGACTGGTGACATAAACCTGGG - Intergenic
1152409496 17:80116000-80116022 AGGACTCTTGAAACTAACCAAGG - Intergenic
1155212600 18:23615143-23615165 GGGACTACAGCCACACACCATGG + Intronic
1155968445 18:32057994-32058016 GGGACTACTGGCATAAGCCACGG - Intronic
1157708882 18:49834317-49834339 AGGGATATTGACACAAAACAAGG - Intronic
1158622064 18:59041345-59041367 AGGACCACTGACATAAGGCACGG - Intergenic
1164223499 19:23219644-23219666 AGGATTACTGACATGAGCCACGG + Intergenic
1164673423 19:30086359-30086381 AGGACAACAGGCAGAAACCAGGG - Intergenic
1164810143 19:31149028-31149050 AGGATTACAGGCACAAGCCATGG + Intergenic
1165989142 19:39796448-39796470 AGAGCTGCTGTCACAAACCAAGG - Intergenic
1166032081 19:40139213-40139235 AGGACTACAGCCACATGCCATGG - Intergenic
1168395022 19:56040215-56040237 GGGATTACAAACACAAACCACGG + Intronic
925420339 2:3704875-3704897 GGGATTACAGACACAAACCGTGG - Intronic
926016060 2:9452511-9452533 AGGCCCACTGATACAAACCTGGG - Intronic
927182477 2:20456418-20456440 AGGGCTACAAACACAGACCATGG + Intergenic
931681481 2:64752725-64752747 AGGACTACTGAAAGAAATCATGG - Intergenic
932886824 2:75556297-75556319 AGAACTAGAGACACAAAGCAGGG + Intronic
934210704 2:89975659-89975681 AGGGATCCTGACACATACCAAGG + Intergenic
935620195 2:105123092-105123114 AGGGCTACTGAGAAAAAACAAGG + Intergenic
939261405 2:139814987-139815009 AGGGCTTCTGATCCAAACCATGG + Intergenic
939427009 2:142052035-142052057 AGGATTACTCACATAAACTAAGG - Intronic
941148449 2:161883719-161883741 AGGTCTATTGCCACAAGCCAGGG - Intronic
942378024 2:175356816-175356838 AGGACTATTGAAAGAAATCAAGG + Intergenic
942574812 2:177352254-177352276 AGGATTACAGGCACAAGCCACGG - Intronic
944461385 2:199954370-199954392 AGGATTACTGGCATGAACCACGG + Intronic
944922939 2:204434419-204434441 AGGTCTACAGCCACAAACCAAGG + Intergenic
946203929 2:218089796-218089818 AGACCTCCTGAGACAAACCAAGG + Exonic
946997813 2:225415536-225415558 AAGTCTACTGCCACAAATCATGG - Intronic
1170185581 20:13586360-13586382 AATACTACTGACACAAAACATGG + Intronic
1174583286 20:51588498-51588520 AAGAATACTGACAAAAAGCAAGG - Intergenic
1175073294 20:56352738-56352760 AGAACTACTGACCCAAACTGAGG - Intergenic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1176582064 21:8540337-8540359 AGGACTCCTGACTCATAACAAGG - Intergenic
1176668372 21:9708643-9708665 AGGGCCACTGACCCAAACAAAGG - Intergenic
1176853947 21:13947468-13947490 GGGATTACAGGCACAAACCACGG + Intergenic
1179107844 21:38419237-38419259 AGAACAACAGGCACAAACCAGGG + Intronic
1180264901 22:10517385-10517407 AGGACTCCTGACTCATAACAAGG - Intergenic
1181630989 22:24151264-24151286 AGGACACCTGGCACAGACCATGG + Intronic
953745153 3:45568413-45568435 AGGACTATGGACACAAAGAAGGG - Intronic
955901230 3:63757661-63757683 AGGACTCTTGAAAGAAACCAAGG - Intergenic
955941133 3:64147777-64147799 TGGAATCCTGAGACAAACCAAGG - Intronic
956608497 3:71097698-71097720 CGGGCCACTGACACAATCCAGGG + Intronic
963526472 3:146421463-146421485 AGGACTATAGACATAAACAAAGG + Intronic
968190815 3:196665842-196665864 ATGACCAGTGATACAAACCAAGG - Intronic
969675244 4:8610817-8610839 AGTCCCACAGACACAAACCAAGG - Intronic
970006578 4:11416679-11416701 AGGAGATCTGACACAAAGCATGG + Intronic
972338280 4:38128206-38128228 AGGACCACTGATAAAAACCCGGG - Intronic
977097217 4:92761602-92761624 AGGACCACTGACACAGAACCAGG - Intronic
978111250 4:104966511-104966533 ACTACTACTTACTCAAACCAGGG + Intergenic
980786373 4:137561338-137561360 AAAACTACTGACATAAAGCATGG + Intergenic
982287299 4:153748519-153748541 AGAACCACTGACTTAAACCAAGG + Intronic
982438147 4:155401275-155401297 AGGATTACAGACACGAACCATGG - Intergenic
982984835 4:162194113-162194135 AGGATTATTTAAACAAACCATGG - Intergenic
983714995 4:170770910-170770932 AGTTCTGCTGCCACAAACCAAGG + Intergenic
984785360 4:183562707-183562729 GGGATTACAGACATAAACCATGG + Intergenic
985071466 4:186170346-186170368 AGGACTCCTGAAATAAAACACGG + Intronic
985217955 4:187672796-187672818 ATGGCTTCTGACACACACCAAGG - Intergenic
988422210 5:31019940-31019962 TGGAATACTGAGGCAAACCATGG - Intergenic
989788158 5:45357120-45357142 AGAAATACTGAGCCAAACCAAGG - Intronic
990378136 5:55193648-55193670 AGGACAGCTGATGCAAACCAGGG - Intergenic
990448102 5:55911446-55911468 AGGACTACTGACCCATAGGAAGG + Intronic
990852250 5:60219809-60219831 TGGACCAGTGACACAGACCAAGG - Intronic
991218282 5:64181840-64181862 AGCACTACTGATATAAAACACGG - Intronic
991491349 5:67186235-67186257 AGGACTACTTGAACAAAACATGG + Intronic
993479981 5:88412666-88412688 AGAATTACAGACAGAAACCAGGG - Intergenic
997282989 5:132660108-132660130 GGGACGACTCGCACAAACCAGGG - Intronic
999331643 5:150677486-150677508 ACTCCTAATGACACAAACCATGG - Exonic
1000212603 5:159121178-159121200 AGTAATACTGCCACAAGCCAAGG - Intergenic
1000841865 5:166230246-166230268 AGCTATACTGGCACAAACCAAGG + Intergenic
1003770456 6:9293254-9293276 AGGAAAACTGACTAAAACCATGG - Intergenic
1003824989 6:9942570-9942592 AGGACTGCAGACGCAAAGCATGG + Intronic
1004020500 6:11771807-11771829 AGGACTACAGACACACACAGAGG + Intronic
1004535475 6:16496653-16496675 AGGACTCTTAAGACAAACCACGG - Intronic
1008321410 6:50118682-50118704 AGGACTACAGACACACACCACGG - Intergenic
1008593694 6:53019791-53019813 GGGACTACTGGCACAAACCATGG + Intronic
1009454462 6:63839647-63839669 AGCACTACTTACAATAACCAAGG - Intronic
1009688637 6:66997145-66997167 AGGTCAATTGAAACAAACCAAGG + Intergenic
1010130623 6:72489167-72489189 GACACTACTGACACAAAACAGGG - Intergenic
1010621946 6:78087568-78087590 AAGAATACTGACACAGACAAAGG + Intergenic
1011551251 6:88532872-88532894 AGGACAACTGGCATAAACCAAGG + Intergenic
1012063914 6:94522680-94522702 AGTAATGCTGCCACAAACCAAGG + Intergenic
1012355693 6:98311223-98311245 GGGAAGACAGACACAAACCATGG + Intergenic
1012648470 6:101720117-101720139 AGGATGAGTGACACAAACGAGGG - Intronic
1013335872 6:109160581-109160603 AGAACTACTGAAACAAATGAAGG + Exonic
1013460042 6:110366023-110366045 AGGACCACAGGCACACACCACGG - Intergenic
1014014165 6:116510556-116510578 AGGATTACAGACATGAACCACGG + Intronic
1014612802 6:123565397-123565419 AGGACATCAGACACAAACCAAGG - Intronic
1016746678 6:147588457-147588479 GGGACTACAGACGCACACCACGG + Intronic
1018388592 6:163326640-163326662 AGAACCACAGACAAAAACCATGG + Intergenic
1019624771 7:2010515-2010537 AGGACTCCTGACACATGCTACGG + Intronic
1020862690 7:13514784-13514806 AGGACTACAGTAACAAAGCATGG + Intergenic
1022790070 7:33679402-33679424 AGGAAAACAGACACAAACAAAGG - Intergenic
1024344458 7:48299015-48299037 AGAGCTACTGCAACAAACCAAGG + Intronic
1024482207 7:49875522-49875544 AGGACTCCAGCCACACACCAAGG - Intronic
1024871791 7:53971913-53971935 AGTAATGCTGCCACAAACCAAGG - Intergenic
1029058353 7:97770814-97770836 GGGACTACTGGCACACACCACGG - Intergenic
1033188220 7:139250103-139250125 AGGACTACAGACACAAGCTATGG - Intronic
1037030323 8:14096362-14096384 AGAACCAATGACAAAAACCACGG + Intronic
1037422053 8:18713016-18713038 AGAACTCCAGACAAAAACCACGG + Intronic
1037974098 8:23197227-23197249 AGGACCCCTGACTCAGACCAAGG - Intronic
1038118237 8:24581950-24581972 GGGACTACAGGCACACACCATGG - Intergenic
1042237160 8:66624839-66624861 GGGATTACAGGCACAAACCATGG - Intergenic
1046410318 8:113833350-113833372 AGAACCAATGACAAAAACCACGG + Intergenic
1047377936 8:124321513-124321535 AGGAATAATGAAACAAACTAAGG - Intronic
1050360073 9:4821748-4821770 GGGACTACAGATACACACCATGG + Intronic
1051037716 9:12769151-12769173 AGGACTACTCACACAGAGGATGG - Intergenic
1053565407 9:39244564-39244586 AGACCTACTGACAAAAAGCATGG - Intronic
1053831174 9:42082411-42082433 AGATCTACTGACAAAAAGCATGG - Intronic
1054131743 9:61374475-61374497 AGACCTACTGACAAAAAGCATGG + Intergenic
1054599373 9:67105027-67105049 AGATCTACTGACAAAAAGCATGG + Intergenic
1057170862 9:92962307-92962329 AGGACCAGGGACACAAACCCAGG - Intronic
1060908916 9:127333329-127333351 AGGACTTCTGACACTGTCCAGGG - Intronic
1062229162 9:135471712-135471734 AGGACATCTGACACAATCCCAGG - Intergenic
1203612082 Un_KI270749v1:18354-18376 AGGACTCCTGACTCATAACAAGG - Intergenic
1203657495 Un_KI270753v1:12312-12334 AGGGCCACTGACCCAAACAAAGG + Intergenic
1187127563 X:16468569-16468591 AGTGATACTGACACAAGCCAAGG - Intergenic
1189259990 X:39671509-39671531 AGGATTACAGGCATAAACCACGG - Intergenic
1197708476 X:129650305-129650327 AGGAGGACTCACAAAAACCAAGG - Intronic
1198147232 X:133869514-133869536 AGGACTACTGACACAAACCATGG + Intronic
1199722645 X:150553184-150553206 AGTTATACTGACACAAGCCAGGG + Intergenic
1200032682 X:153309188-153309210 AGTTCTGCTGCCACAAACCAAGG - Intergenic
1201614455 Y:15881811-15881833 AGCACTACTCACAATAACCAAGG - Intergenic
1201615913 Y:15897964-15897986 AGCACTACTCACAATAACCAAGG + Intergenic