ID: 1198147736

View in Genome Browser
Species Human (GRCh38)
Location X:133874402-133874424
Sequence ATATATGTGCATAAAATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 408}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198147736 Original CRISPR ATATATGTGCATAAAATGGA AGG (reversed) Intronic
901212797 1:7535961-7535983 ATTTCTGTGCATGAAATGCAAGG + Intronic
901661264 1:10799339-10799361 ATATTTGAGAAAAAAATGGAGGG - Intergenic
902601724 1:17544251-17544273 ATATATATGTATAAAATTTATGG - Intronic
902829873 1:19005442-19005464 ATAAATCTCCATATAATGGAGGG + Intergenic
904758587 1:32784379-32784401 ATATATAGGAATAAAATGGGGGG - Intronic
904979730 1:34488480-34488502 ATATGTGTGTATAGAAGGGATGG - Intergenic
905096287 1:35473784-35473806 ATGTGTGTACCTAAAATGGAAGG + Intronic
905163793 1:36063690-36063712 ATGAATGTGAATAAATTGGAAGG + Exonic
906700640 1:47855421-47855443 ACATATGTGCATAAACAGTATGG + Intronic
906879674 1:49576460-49576482 AGTTATGTGCAGAAAATGGCAGG - Intronic
907772686 1:57481402-57481424 ATATATGTGAATAAAATTCTTGG - Intronic
908082267 1:60593846-60593868 ATAAATGTGAATAAAATAAACGG - Intergenic
908840504 1:68275572-68275594 ATATATTTCCATAACATGAAGGG + Intergenic
908945393 1:69490014-69490036 AAATATATGAATAAAATTGATGG + Intergenic
909079663 1:71094378-71094400 CTATATGTGCTTCAAATGAATGG - Intergenic
909224538 1:73001036-73001058 ATATATGTGAATAAATGGTATGG + Intergenic
909328674 1:74385840-74385862 ATGAAAGTGCATAAATTGGATGG + Intronic
911291211 1:96058590-96058612 ATATATGTGCTTAGAATTAAAGG - Intergenic
911448071 1:98025055-98025077 GTATATGTGCTTAAAATTGCTGG + Intergenic
913005351 1:114624938-114624960 AGATATATTAATAAAATGGAAGG + Intronic
913377910 1:118174980-118175002 AGATATGTGAATAGATTGGAAGG + Intronic
914674534 1:149898579-149898601 ATATAAATGCAAAAAATGGTGGG + Intronic
915595866 1:156896197-156896219 ATATTTCTTCATAAAATGGGAGG + Intronic
915649669 1:157300333-157300355 ATACATGTGCAGAACATGCAGGG - Intergenic
916940676 1:169673974-169673996 ACATATGTACATACAATGGACGG - Intronic
917830607 1:178881003-178881025 ATATATGTCAATGTAATGGAAGG - Intronic
918140017 1:181712210-181712232 ATATTTGTCAATAAAAGGGACGG + Intronic
919324302 1:196086876-196086898 ATATATGACCAAAAAAGGGAAGG + Intergenic
919357776 1:196547667-196547689 TTATATGTAGATATAATGGATGG - Intronic
919959680 1:202453818-202453840 ATTTCTTTACATAAAATGGAAGG + Intronic
920461889 1:206146874-206146896 ATATATATGCATAAAAAGGCAGG + Intergenic
920989221 1:210920514-210920536 ATATATGTGCTGAAAATGGTTGG + Intronic
922224962 1:223638075-223638097 AAATATTTGAAAAAAATGGATGG + Intronic
922267921 1:224004269-224004291 ATATATGTACTCAAAATGAAAGG - Intergenic
922873702 1:228923467-228923489 ACATATGTGAAGTAAATGGATGG + Intergenic
923450772 1:234115370-234115392 ATGTAAGTGCATACAAGGGAAGG - Intronic
924228195 1:241940451-241940473 ATATATGTATATAAAATTGGTGG - Intergenic
1065428771 10:25632416-25632438 AGCTATCTGCATAAAATGGGGGG - Intergenic
1066350699 10:34634360-34634382 ATATATGTGCAGAAAATTTCTGG + Intronic
1066725782 10:38391342-38391364 ATATATGTACTCAAAATGAAAGG + Intergenic
1067361051 10:45579198-45579220 ACATATATGCATAAAAAGAAAGG + Intronic
1067916858 10:50409005-50409027 ATCTATATGAATAAAATGAATGG - Intronic
1068163221 10:53294878-53294900 ATATATGTACATAAAGTGTTTGG - Intergenic
1068245075 10:54354849-54354871 AAATATATGTATTAAATGGAAGG + Intronic
1068381631 10:56261528-56261550 ATAGCTGTACATAAAATGAATGG + Intergenic
1068416595 10:56731928-56731950 ATAAATGTTTATAAAATGAATGG + Intergenic
1068523199 10:58100232-58100254 ATACATGTGCAGAACATGCAGGG + Intergenic
1068800022 10:61130193-61130215 TTCTTTGTGTATAAAATGGAAGG - Intergenic
1068820128 10:61365863-61365885 ACATATGTGCATAAAATGTTAGG + Intergenic
1069554940 10:69391696-69391718 ATATATGTGTATAAAATATTAGG - Intronic
1071037941 10:81269865-81269887 ATATATGTACATAAATCTGATGG - Intergenic
1071770355 10:88722338-88722360 ATAAATGCCAATAAAATGGATGG - Intergenic
1072932895 10:99682639-99682661 ATATATGTGAACAGAAAGGAGGG - Intronic
1073349163 10:102807362-102807384 ATATATGGACAGAAAAAGGAGGG - Intronic
1073364796 10:102930285-102930307 ATATATATGTATACACTGGAAGG + Intronic
1073863819 10:107777935-107777957 AAAAATGGGCATAAACTGGAGGG - Intergenic
1073938511 10:108664600-108664622 TGATATTTGCAGAAAATGGAAGG - Intergenic
1073994369 10:109298829-109298851 ATATTTGTATATAAAATTGAAGG - Intergenic
1074184339 10:111087841-111087863 ATATATTTTTAAAAAATGGAAGG - Intergenic
1077831387 11:5874991-5875013 ATATATATGTATAAAATTGATGG - Intronic
1078974697 11:16459861-16459883 ATATACATGTATAATATGGAGGG + Intronic
1079730141 11:23930277-23930299 ATTTATGTGAATAACAAGGATGG + Intergenic
1080358716 11:31487123-31487145 ATATATTTTTATAAAAAGGAAGG + Intronic
1080956863 11:37107852-37107874 ATATATGTACATAAAACATATGG + Intergenic
1081473956 11:43406050-43406072 CTTTAAGTGTATAAAATGGAAGG + Intronic
1081790838 11:45783074-45783096 TGATATGTCCATACAATGGAAGG - Intergenic
1084874572 11:72121440-72121462 ATATATATATATAAAATGTATGG + Intronic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1085834502 11:79937897-79937919 CTATATATGCAAAAGATGGATGG - Intergenic
1085910434 11:80818466-80818488 ATATATATGAATATTATGGAAGG - Intergenic
1086179167 11:83929735-83929757 ATATATGTACATACATAGGATGG + Intronic
1087690130 11:101311255-101311277 ATATATATATATAAAATGGATGG - Intergenic
1087915161 11:103801396-103801418 ATATAGTTGTAAAAAATGGAAGG + Intergenic
1088923287 11:114277384-114277406 ATATATATGCATGAAATGAGTGG + Intronic
1090693046 11:129205653-129205675 ATAGATGTTCAAAAAATGGAAGG + Intronic
1091572335 12:1698688-1698710 ATAAATATACATAAAATGTATGG - Intronic
1091997403 12:5004584-5004606 ATTTATGGACAGAAAATGGAAGG + Intergenic
1094386719 12:29902441-29902463 ATATATTTTCATAAAATATAGGG - Intergenic
1094467001 12:30763824-30763846 TTACATGTGCATAAAATCTATGG - Intergenic
1094631677 12:32181568-32181590 ATTTATATGCATAAAATGAGAGG - Intronic
1096750678 12:53756925-53756947 AGATGTGTGGATAAAAAGGAGGG + Intergenic
1096880420 12:54663772-54663794 ATATATGTTTATAAATTGGTGGG - Intergenic
1097964476 12:65564185-65564207 ATATAAGTCCATGAAATGGAAGG - Intergenic
1098142061 12:67459891-67459913 ATACATATGCAGAAAAGGGAAGG - Intergenic
1098583664 12:72131574-72131596 ATATATTTGCATGAAATGATTGG + Intronic
1098754504 12:74342341-74342363 CTATATATTTATAAAATGGAAGG - Intergenic
1101457049 12:104844802-104844824 ATATATGTTAATTAAATGAAAGG + Intronic
1102194495 12:111015028-111015050 ATATTTCTGCAGCAAATGGATGG - Intergenic
1102397222 12:112597090-112597112 ATATATCTGCATAAAATCATAGG + Intronic
1103453970 12:121050252-121050274 ATAAATGGGCAGAAAATTGAAGG + Intergenic
1106261259 13:28068934-28068956 ATATATGTTTTTAAAATAGAGGG + Intronic
1106339335 13:28813885-28813907 ATATATGTGCAAAAAAAGACAGG + Intergenic
1106900402 13:34349517-34349539 ATCTGTGTCCACAAAATGGAGGG + Intergenic
1106957226 13:34953683-34953705 ATATATGAGAAAAAAATGGATGG + Intronic
1107556817 13:41522963-41522985 ATATATTTGTTTAAAATGTAGGG + Intergenic
1107593571 13:41936816-41936838 ATATATGTATATATTATGGAAGG - Intronic
1109041533 13:57344846-57344868 ATATATAAGAATAAACTGGAGGG - Intergenic
1109060141 13:57606616-57606638 ATATATTTTATTAAAATGGAGGG - Intergenic
1109589720 13:64462672-64462694 TTATATGTGTATAGGATGGAGGG - Intergenic
1109624651 13:64958863-64958885 ATGTATGTACATGTAATGGATGG + Intergenic
1109646872 13:65270451-65270473 AAATATGTGCATACAATAAAAGG + Intergenic
1110485366 13:76034922-76034944 ACATACATGCATACAATGGAAGG + Intergenic
1111349671 13:87010850-87010872 ATCTCTCTGCATAATATGGATGG + Intergenic
1111422764 13:88037419-88037441 ATAAATGTGCATTTAATGGGTGG - Intergenic
1111561578 13:89956394-89956416 ATATATTTGCATAAAATATGTGG + Intergenic
1112884615 13:104153748-104153770 ATATATGTTAATAAATTGGTAGG - Intergenic
1112987016 13:105463447-105463469 ATATATGTGCAGCAAATTGTGGG - Intergenic
1113348137 13:109500662-109500684 ATGTATGTGCAATAAATGTATGG + Intergenic
1115145144 14:30217948-30217970 CTTTATGAGCTTAAAATGGATGG + Intergenic
1116311583 14:43333993-43334015 AAATATGTGTTCAAAATGGATGG + Intergenic
1116479458 14:45381432-45381454 ATGAATGAGAATAAAATGGAGGG + Intergenic
1116809753 14:49527829-49527851 ATAAAAGTACAGAAAATGGAAGG + Intergenic
1117056799 14:51920470-51920492 AAATATTTGGAAAAAATGGATGG - Intronic
1117526825 14:56615992-56616014 ATATATTTGCACAAACTGCAAGG - Exonic
1117629703 14:57677711-57677733 ACATATATGCATAAAATGAAAGG + Intronic
1117929519 14:60825591-60825613 TTATATCTTCATAAAATAGATGG + Intronic
1118648328 14:67862934-67862956 ATAAATATGCATATATTGGAGGG + Intronic
1118666733 14:68077988-68078010 TTATATGTACATAAGGTGGAAGG + Intronic
1118723824 14:68612784-68612806 ATATTTGACCATAAAAAGGAAGG + Intronic
1118903916 14:70009749-70009771 ATGTATGTACATAAAATCTAGGG + Intronic
1119211008 14:72831783-72831805 ACACATGTGCATAAAAGGTAGGG + Intronic
1119604959 14:76007622-76007644 AGAAATGTGCATAATATTGAAGG - Intronic
1119936121 14:78593929-78593951 ATTCATGTGCATGATATGGAAGG + Intronic
1120938152 14:89918951-89918973 AGATCTCTGCATGAAATGGAAGG + Intronic
1121903298 14:97714820-97714842 AAATATGTGCAAAAAATACAGGG + Intergenic
1202891345 14_KI270722v1_random:161660-161682 AAAAATGTGCATAAAATGCCTGG + Intergenic
1124214088 15:27792295-27792317 ATTCATGTGCATAAAAAGCATGG - Intronic
1125803342 15:42470145-42470167 ATATATGTGTATAATAGAGATGG - Intronic
1126897885 15:53279523-53279545 ATACATGTGCAGAATATGCAGGG + Intergenic
1127896075 15:63300014-63300036 TTATATGTGCATGAAATGGCAGG + Intronic
1130216380 15:81974256-81974278 ATATCTGAGCATAAAATGGAAGG + Intergenic
1130783564 15:87071113-87071135 ATAAATGCACATAAAATGAATGG + Intergenic
1131708021 15:95019761-95019783 TTATATCTCAATAAAATGGAAGG - Intergenic
1133993029 16:10725492-10725514 ATATATATGTATAAAATAAATGG + Intergenic
1134437343 16:14272891-14272913 ATAAATGTGCTTAAAATAAATGG - Intergenic
1136741454 16:32533357-32533379 ATATATGTTCAGAAAAAAGAAGG - Intergenic
1138289397 16:55833778-55833800 GTAAATGTTCACAAAATGGATGG - Intergenic
1138632016 16:58304065-58304087 ATATGAGTGGATAAAAAGGAAGG - Intronic
1138814207 16:60185675-60185697 AAATAAATGAATAAAATGGAGGG + Intergenic
1138960179 16:62019789-62019811 ATATATATGCATATACTGAAGGG + Intronic
1140161347 16:72497893-72497915 ATGTCTGTGCATAAAATTCAGGG + Intergenic
1140672861 16:77296158-77296180 ATATATTTATATAAAATGGATGG - Intronic
1203028149 16_KI270728v1_random:541877-541899 ATATATGTTCAGAAAAAAGAAGG + Intergenic
1203043572 16_KI270728v1_random:792554-792576 ATATATGTTCAGAAAAAAGAAGG - Intergenic
1142778341 17:2160153-2160175 ATATATTTACATACAATGAAAGG - Intronic
1143005797 17:3832739-3832761 ATATATCTGCAGAAGAAGGATGG - Intronic
1144315305 17:14055125-14055147 AAATATTTGAATAAAATGAAAGG - Intergenic
1145824207 17:27864636-27864658 ATATCTGGGGAAAAAATGGACGG + Intronic
1148885704 17:50771179-50771201 ATAGATGGGAATGAAATGGAAGG - Intergenic
1149173407 17:53840933-53840955 ATATATGTTCAAAAATTGCATGG - Intergenic
1149941923 17:60879325-60879347 TTATATGTGAATACAATGAAGGG + Intronic
1150717266 17:67582724-67582746 AAGTATGTGCATAAAATAAATGG - Intronic
1153555483 18:6308717-6308739 GTATATGTGCATAAAAGGTTTGG + Intronic
1154047366 18:10919014-10919036 ATATATTTGAATAAATTTGAGGG - Intronic
1154073967 18:11180809-11180831 ATATATCTTCGTAAAATGAATGG - Intergenic
1154173945 18:12070078-12070100 ATATATTTGAATAAATTTGAGGG + Intergenic
1156295404 18:35784856-35784878 ATTTTTGTAAATAAAATGGAAGG + Intergenic
1156942965 18:42793176-42793198 TTAAATGTGCATAATATGGGAGG + Intronic
1157169849 18:45393233-45393255 ATATATGTATATAAAATGTTGGG + Intronic
1157950092 18:52026782-52026804 ATAGAAGTGCAGCAAATGGAGGG - Intergenic
1158624894 18:59062585-59062607 ATAGATTTGACTAAAATGGAAGG - Intergenic
1159256933 18:65958749-65958771 ATATAGGTGAATAAAATCGTAGG + Intergenic
1159416833 18:68162022-68162044 ATATATGTAAATAAAGAGGAAGG + Intergenic
1159436143 18:68420299-68420321 ATATATTTTCAGAAAATTGAAGG - Intergenic
1159879534 18:73845337-73845359 ATTTATCTGCATAACATGCATGG - Intergenic
1159930958 18:74312519-74312541 ATATATGTATATAAAATGTTTGG - Intergenic
1160040336 18:75339342-75339364 AGATATGAGCAGAATATGGATGG - Intergenic
1163488825 19:17605480-17605502 ATATTTGTGCAAAAAATAAATGG - Exonic
1167168988 19:47818430-47818452 ATAAATGTGAAAGAAATGGATGG - Intronic
926666391 2:15528569-15528591 ATATATATGCATACACTGGCCGG + Intronic
927631922 2:24781776-24781798 ATATATGGGCCTGAAATGTAGGG + Intergenic
927693155 2:25222518-25222540 GTGTATGTGCATAAAACAGATGG + Intergenic
927745330 2:25614653-25614675 TACTATGTTCATAAAATGGAAGG + Intronic
928587085 2:32770907-32770929 ACATATGTGAATAATATGTACGG + Intronic
928616420 2:33044160-33044182 ATACATGTGCAGAACATGGCAGG + Intronic
928967282 2:36989471-36989493 ATATATTTGGTTAAAATGGGAGG - Intronic
929578018 2:43064695-43064717 TTAAATATGCTTAAAATGGAAGG - Intergenic
930447418 2:51491461-51491483 ATACATTTCCATAAAATGAATGG - Intergenic
930560677 2:52956573-52956595 TTATAAGTGAATAAGATGGAAGG + Intergenic
931140015 2:59447225-59447247 ATGTATGTGGTTAAAATTGAGGG - Intergenic
931182722 2:59919052-59919074 ACATGTGTGCGTAAAATGAATGG + Intergenic
931211457 2:60200640-60200662 ATATATGTGCAGAACGTGCAGGG + Intergenic
933135914 2:78735028-78735050 ATATATGTGTATGAGATAGAAGG - Intergenic
933530389 2:83502501-83502523 AAATAAGAGCATAAACTGGATGG + Intergenic
935432171 2:102988027-102988049 ACATATGTGCAGACAATGGTAGG + Intergenic
935894436 2:107719603-107719625 TTATATGGGTATAAAATGGGGGG - Intergenic
937481384 2:122263592-122263614 TTATATGTGCACAACATGCAAGG - Intergenic
937729592 2:125212384-125212406 AGATATCTGAATAAGATGGATGG - Intergenic
937761405 2:125607875-125607897 GTATATGTACATAAAATAGATGG + Intergenic
938244761 2:129767968-129767990 AGAAACGTGCACAAAATGGAAGG + Intergenic
938827580 2:135021001-135021023 ATTAATGTACATAAAAAGGAAGG + Intronic
938997368 2:136694569-136694591 ATATATATGCAAAAAATAAATGG + Intergenic
939172899 2:138716261-138716283 TTATATCCCCATAAAATGGATGG + Intronic
939298555 2:140303103-140303125 ATATATATGCATAAAATAAATGG + Intronic
940357768 2:152764356-152764378 ATACATGTGTATAGAAGGGAAGG - Intergenic
940511841 2:154625369-154625391 ATATACATGCACAAAATTGAGGG - Intergenic
940591058 2:155728295-155728317 ATCTTGGTGCATAAAAGGGAAGG - Intergenic
940628302 2:156205036-156205058 ATATATGTAAATATAATGGAAGG - Intergenic
940935094 2:159483925-159483947 AAATATGTGCAAAAGATGAAGGG + Intronic
941429502 2:165396065-165396087 AAATATATTCATAAAATTGAAGG - Intergenic
941562238 2:167060983-167061005 ATATATAAGCATAAATAGGAAGG - Intronic
941624281 2:167813502-167813524 ATAAATAGGCATAAAATGGGGGG - Intergenic
942428084 2:175880317-175880339 ATATATGTGCTGAATAAGGAAGG - Intergenic
942575504 2:177359243-177359265 ATATATGTGTATGATATGTATGG - Intronic
943249057 2:185494272-185494294 ATATATGTCCAGAAAAAGCAGGG + Intergenic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
943820996 2:192320778-192320800 ATATATATGCATAGAGTGGCTGG - Intergenic
943908171 2:193527973-193527995 ATATATGAGATTAAAATTGAGGG - Intergenic
948079412 2:235193281-235193303 GGAAATGTGCATAAAATGGAAGG + Intergenic
1169070266 20:2723070-2723092 ATATATGTGTCAAAAATTGATGG - Intronic
1171887812 20:30672454-30672476 AAATATGTGGAGAAAATAGAAGG - Intergenic
1173014450 20:39212255-39212277 ATATGTGTGCATGAAATGTGGGG - Intergenic
1173413320 20:42834807-42834829 ATATATGTGTACCAAAAGGAGGG + Intronic
1174654970 20:52163717-52163739 ATAAATGTGTATAAGATGCAGGG - Intronic
1175084183 20:56445126-56445148 TTATATGTATATAAATTGGATGG + Intronic
1176882491 21:14214706-14214728 ATATATGTTGATCAAATGAATGG - Intergenic
1177275120 21:18901186-18901208 ATATATTTCCACAAAATGCACGG + Intergenic
1177706799 21:24716151-24716173 ATAAATGTAAATAAAAGGGATGG - Intergenic
1178265506 21:31138983-31139005 AGAAATGTGCAAAAGATGGAAGG - Intronic
1181351334 22:22260621-22260643 GTATATGTGCAGAACATGCAGGG - Intergenic
1183920437 22:41163065-41163087 CTAGATGTTCCTAAAATGGATGG + Intronic
949306711 3:2650081-2650103 ATATATATATATAAAAGGGAAGG + Intronic
951069749 3:18313285-18313307 ATATCTAGGCATAAAATGGCTGG + Intronic
951212387 3:19989907-19989929 AAATATGTACTTACAATGGAAGG + Intronic
954955376 3:54513997-54514019 TTATATGTGCGGCAAATGGAAGG + Intronic
957142091 3:76373427-76373449 TTATATGTGCATAATTTGGATGG + Intronic
957379633 3:79409917-79409939 ATATATGTGCAAATAATGCTTGG - Intronic
957612302 3:82483940-82483962 AGAAAAGTGGATAAAATGGAGGG + Intergenic
957784043 3:84857381-84857403 ATATATGCATATAAAATGAAAGG + Intergenic
958503190 3:94940965-94940987 ATATATATACATAATATGCAGGG + Intergenic
958638186 3:96772411-96772433 ATAAATTTGAATAGAATGGAAGG + Intergenic
959407061 3:105972901-105972923 ATATATGGATATAAAAAGGATGG - Intergenic
959668134 3:108944166-108944188 ATATATGGGGAAAAAAAGGAGGG + Intronic
959880645 3:111441174-111441196 ATACATGTGCAGAACATGCAGGG + Intronic
960203212 3:114863195-114863217 ACATATATCCATAAAGTGGAGGG + Intronic
961364866 3:126393113-126393135 GGATAACTGCATAAAATGGAAGG + Intergenic
962067522 3:131997515-131997537 CTTTATGTGAATAAAATGAAAGG + Intronic
962070815 3:132032630-132032652 AGAGAGGTGCATAAAATAGAGGG - Intronic
962618879 3:137157114-137157136 ATAAATCTGTATTAAATGGATGG - Intergenic
962641185 3:137388323-137388345 ACATATGTATATATAATGGATGG - Intergenic
963220950 3:142811539-142811561 ATAAATTTGCCTAAAATTGAAGG - Intergenic
963392897 3:144691124-144691146 CTAAATTTGCATAAAATGTATGG - Intergenic
963426258 3:145129600-145129622 AAAAATGTGCATACAATGTAAGG - Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964785670 3:160393326-160393348 ATATGTGTTTATAATATGGAAGG + Intronic
964980097 3:162667724-162667746 ATATATGTTCTTAAATTGTATGG + Intergenic
965495883 3:169398584-169398606 ATATATGGACACAAAATAGATGG - Intronic
965503746 3:169487766-169487788 AGATATATGCAAAAAAGGGAGGG + Intronic
965513291 3:169592917-169592939 ATATATGTACATAAAAAATACGG + Intronic
965525141 3:169708372-169708394 ATATGTCTTCATACAATGGAAGG - Intergenic
966007403 3:175032834-175032856 ACATTTGGGCATAAAGTGGATGG + Intronic
966227063 3:177609501-177609523 ACATATGTGCCCAAAATGGTTGG + Intergenic
967388068 3:188929659-188929681 CTATATGTGCAGACCATGGAAGG - Intergenic
970050566 4:11909822-11909844 ATATATCTGCAAAAAAAGTAAGG - Intergenic
970125300 4:12803086-12803108 AAGTATGTGCAAAAAATGAAAGG + Intergenic
970630663 4:17940214-17940236 ATATATGTATATAAAATCTAAGG + Intronic
970688634 4:18596849-18596871 ATCAATGTTTATAAAATGGATGG + Intergenic
971672947 4:29587336-29587358 GTAAATTTGCATAAGATGGAAGG + Intergenic
972387095 4:38577667-38577689 ATAAATGTCCATGAAATGGGTGG - Intergenic
973305745 4:48647337-48647359 AGATATGTTAATAAAATAGAGGG + Intronic
973565163 4:52178539-52178561 AAATATGTGCAAAGAATTGAAGG + Intergenic
974358059 4:60837513-60837535 ATATATATGAATGAAATAGATGG - Intergenic
974551288 4:63378828-63378850 ATAAATGTGTAAAAAATAGATGG - Intergenic
974666847 4:64972793-64972815 GTAAATGTGCATAAATTAGACGG + Intergenic
975060213 4:69987847-69987869 AAATATGTGCATATTATGTATGG + Intergenic
975615724 4:76245037-76245059 AAATGAGTGGATAAAATGGATGG - Intronic
975634013 4:76427992-76428014 TTATATATACATAAAATTGAGGG - Intergenic
975787094 4:77903132-77903154 ATATATGTACATAAAAATAAAGG + Intronic
976154987 4:82134245-82134267 ATATATTTTGATTAAATGGAAGG + Intergenic
977752238 4:100623315-100623337 ATATATGTTCAAAAATTGTATGG - Intronic
977965379 4:103140769-103140791 AAATATGTGAATATAATGGTAGG + Intronic
978105965 4:104902209-104902231 ATATATGTTTATAACATGGGAGG - Intergenic
978435313 4:108677680-108677702 ATAAATGTGCATACATTGGCAGG + Intergenic
978657419 4:111080626-111080648 ATATGTGTGCAGAACATGCAGGG - Intergenic
978928362 4:114279056-114279078 AAAAATGTGTATAAAATAGAGGG - Intergenic
979151850 4:117327403-117327425 ATATATTTGTATAAAATAAAGGG - Intergenic
979335907 4:119462469-119462491 ATATATGTACTCAAAATGAAAGG - Intergenic
979959097 4:126994532-126994554 AAATATGTACATAGAATGGCTGG + Intergenic
979981408 4:127260302-127260324 ATAGATGTGCATAAAACGTAAGG - Intergenic
980538056 4:134155224-134155246 ATATTTCTGTGTAAAATGGAAGG + Intergenic
981131048 4:141158853-141158875 TTATCTGTGAATAAATTGGAAGG - Intronic
981727897 4:147867206-147867228 GTAAATATGCATAAAATGTAGGG - Intronic
982265716 4:153536734-153536756 ATATATATACATAGAAGGGAGGG - Intronic
982940297 4:161543104-161543126 ATAAATGAGTATATAATGGAAGG + Intronic
983256475 4:165405892-165405914 TTATATTGGCATAAAATGGCAGG + Intronic
983323074 4:166219026-166219048 ATATATGTTCTTAGAATAGAAGG + Intergenic
983480122 4:168263339-168263361 ATATTTGTGGAAAAAATGAATGG - Intronic
984754069 4:183308849-183308871 ATATTTGGGAAAAAAATGGATGG - Intronic
984994415 4:185415068-185415090 ATATATTTCCACTAAATGGAAGG - Intronic
985017007 4:185647018-185647040 ATATTTGTGCTTAAAATAGGTGG + Intronic
985898985 5:2772007-2772029 ATATACAAGCATAGAATGGAAGG + Intergenic
986668056 5:10120249-10120271 ATATGTGTGCTTAAAATTCATGG + Intergenic
986723991 5:10580852-10580874 AAATATGTTCATGAAAAGGAGGG - Intronic
988105355 5:26740132-26740154 ATATCTGAGCAAAAAATGGTAGG + Intergenic
988209298 5:28182732-28182754 GTATATGTACATATAATTGATGG - Intergenic
989164678 5:38422718-38422740 AAAAATGTGCAATAAATGGAAGG + Intronic
989281890 5:39654034-39654056 ATATATGTTCAAAAATTGAATGG + Intergenic
989530633 5:42503913-42503935 TTATATGTGCTTAGAATGAAAGG + Intronic
990274143 5:54177395-54177417 AAATATGTGCTTAAAAAGGAAGG + Intronic
991394737 5:66192208-66192230 AGACATTTGCATTAAATGGATGG + Intergenic
992607770 5:78477783-78477805 ATATATGTGCATTGAAATGATGG + Exonic
993629096 5:90262253-90262275 ATATATGTGCATATATATGAGGG + Intergenic
994177386 5:96725814-96725836 TTATATTTGCATAAACTGAAAGG + Intronic
994966745 5:106682392-106682414 ATACCTGTGCATATAATGGTGGG - Intergenic
996430079 5:123365490-123365512 ATATATGAAAATAAAATGAAAGG + Intronic
998505878 5:142672112-142672134 ATATATGTGCATAAATAGATAGG + Intronic
999182515 5:149680274-149680296 AAGAATGTGCATAAAATGGCTGG - Intergenic
999564403 5:152841312-152841334 CAATATGAGCATAAAATGGCAGG + Intergenic
999582842 5:153058800-153058822 AAAGATGTGCATTGAATGGAAGG + Intergenic
1000542338 5:162555400-162555422 ATATATGTTGATTAAATGAATGG + Intergenic
1001949285 5:175804967-175804989 TTACATGTGAACAAAATGGAGGG - Intronic
1003156060 6:3595796-3595818 ATATATGTGCATAAAAGACGAGG + Intergenic
1003272787 6:4621983-4622005 ACATATGTACATTCAATGGAAGG + Intergenic
1004153780 6:13148570-13148592 GTATATGTGAAAAAAAAGGAAGG - Intronic
1005112991 6:22306012-22306034 ATATATGTATATAAAATAAAGGG + Intergenic
1005429928 6:25745306-25745328 ATATATGTTAATAAAATCCATGG - Intergenic
1006971362 6:38048842-38048864 ATATATGTGAAATAAATGCAAGG - Intronic
1008080870 6:47193358-47193380 ATATATGTATATAAAAAGGGAGG + Intergenic
1008724389 6:54399127-54399149 AGATATTTGCCTAAAATGTAAGG + Intergenic
1008886675 6:56438562-56438584 ATATACTTGCATAACATGCAGGG + Intergenic
1010505477 6:76652753-76652775 ATCTATGTACAGAAAATGCAAGG - Intergenic
1010926910 6:81754271-81754293 ATATATATGTATAAAATGCCTGG - Intergenic
1010944772 6:81960864-81960886 ATATATGTGCAAAATATTAAGGG + Intergenic
1011223754 6:85084931-85084953 ATACATGTGCATAATGTGCAAGG - Intergenic
1011589676 6:88960141-88960163 AGAACTGTGCTTAAAATGGATGG + Intronic
1011798708 6:90985066-90985088 ATATATTTACACAAAATGTATGG - Intergenic
1011867432 6:91847649-91847671 ATATATGTATATGAAATGAATGG + Intergenic
1011903354 6:92329310-92329332 GTATTTGTGCATAAAAATGATGG - Intergenic
1011987132 6:93462373-93462395 AAATATTTGGAAAAAATGGAGGG + Intergenic
1012665838 6:101968146-101968168 TTATATTTGCATAAGATGCATGG - Intronic
1013351415 6:109309460-109309482 ATATATGGTCTTCAAATGGAAGG + Intergenic
1013494825 6:110688341-110688363 ATATATATATATAAAATGCAGGG + Intronic
1013515074 6:110877179-110877201 TTACATGTCCACAAAATGGATGG - Intronic
1015861825 6:137689467-137689489 TTATATGTGCAAAATTTGGAAGG + Intergenic
1016190121 6:141254862-141254884 ATATATATGCATTAAATCAAGGG + Intergenic
1016408283 6:143755010-143755032 ATATATATGCAAATAATGAACGG - Intronic
1016556581 6:145345614-145345636 AGATAGGTGCATAAAATGGAAGG - Intergenic
1016604253 6:145901040-145901062 ATATATGTAGATATTATGGAAGG - Intronic
1016713695 6:147201645-147201667 ATTTATGAGCATGAACTGGAGGG - Intergenic
1022321838 7:29295212-29295234 AAATATTTGAAAAAAATGGATGG - Intronic
1023608979 7:41955521-41955543 ACAGATGTGGATCAAATGGAAGG + Intergenic
1023645897 7:42314459-42314481 ATGTATTTGCTTAAAATGAAGGG - Intergenic
1023757026 7:43429275-43429297 ATATATATGCATATAATATATGG - Intronic
1024067899 7:45757402-45757424 ATATATGTACTCAAAATGAAAGG + Intergenic
1025531287 7:61887946-61887968 ATATATGTTCAGAAAAAAGAAGG - Intergenic
1028415180 7:90572582-90572604 AAATATGTGCTAAAAATGGGAGG - Intronic
1030902317 7:115139928-115139950 CTATCTGTGCAGAAAAAGGAGGG + Intergenic
1031109566 7:117591109-117591131 GTATATGTATATAAAATGGCTGG + Intronic
1031408455 7:121413672-121413694 ATATATATATATAAAATGTAGGG - Intergenic
1031888361 7:127264465-127264487 AGACATGTGAATAAAAGGGATGG + Intergenic
1032816274 7:135477879-135477901 ATATATTGGCATAAAATATAAGG - Intronic
1032898734 7:136281973-136281995 AAACATATACATAAAATGGAAGG + Intergenic
1033030176 7:137818744-137818766 AAATATGGGCAAAAAATGGTGGG - Intronic
1034855512 7:154542681-154542703 ATAAATGTTTATAAAATGGATGG - Intronic
1035142657 7:156778533-156778555 AAATATGTTCATTAAATGCAAGG + Intronic
1035495057 7:159317451-159317473 ATTTATGGGCAGAAAATGGAAGG - Intergenic
1035989953 8:4478539-4478561 ATATCGGTACATTAAATGGAAGG - Intronic
1036608188 8:10326620-10326642 ACAACTTTGCATAAAATGGAGGG + Intronic
1036981241 8:13472293-13472315 ACATATGTACATTAAATGAAGGG + Intronic
1036985392 8:13522966-13522988 ATTAATGTGGCTAAAATGGAAGG + Intergenic
1037041628 8:14243536-14243558 ATTTATGTTCATAACATGTAAGG + Intronic
1037410033 8:18586578-18586600 ATATATGTGTTTACAATGAAGGG + Intronic
1038449733 8:27632491-27632513 ACATATATGCAGAAAATGGCAGG - Intergenic
1038954740 8:32455331-32455353 ATTTATAGGCATAAAAAGGATGG - Intronic
1039147031 8:34459340-34459362 GTATGTGTAGATAAAATGGATGG - Intergenic
1039237535 8:35518322-35518344 AGATATATAAATAAAATGGAAGG - Intronic
1039811763 8:41055238-41055260 CTATATTTGCAAAAAATGAAAGG - Intergenic
1040447363 8:47508931-47508953 ATATATATATATAAAATGGAAGG - Intronic
1041174486 8:55180287-55180309 ATGAATGAGCATAAATTGGATGG + Intronic
1041347836 8:56919750-56919772 ATATGTGTGCAGAACATGCAGGG - Intergenic
1042403959 8:68381946-68381968 ATATATGTGCATTAAAAGACTGG - Intronic
1043012101 8:74893767-74893789 ATATAAATGCATAGGATGGATGG + Intergenic
1043065864 8:75569118-75569140 ATAAATTTGAATAAAATGGGAGG - Intergenic
1043701462 8:83293261-83293283 ACATATGTGCATCAAATTGCTGG - Intergenic
1044334818 8:90968678-90968700 ATATATATGCACACACTGGAAGG + Intronic
1044939299 8:97324348-97324370 TTATATGTCAATAAAATTGAGGG - Intergenic
1045334769 8:101189966-101189988 AAGTATGTGCATATAATTGATGG + Intronic
1046438041 8:114220215-114220237 ATTTAAGTGCTTAAACTGGAGGG - Intergenic
1046720242 8:117611003-117611025 ATATATGGACAGAAAAAGGAAGG + Intergenic
1047593925 8:126357262-126357284 ATATATATATATAAAAAGGAGGG + Intergenic
1048359064 8:133680068-133680090 ATATATAGGCATATGATGGAAGG - Intergenic
1048710133 8:137200809-137200831 ATATATGGGGAGAAAATGGCAGG - Intergenic
1050710198 9:8453062-8453084 TTATTTGTGTATAAAATAGAGGG + Intronic
1050915075 9:11121600-11121622 ATACATGTGCAGAACATGCAGGG - Intergenic
1051203089 9:14651878-14651900 ATTTAAGTGAATAAAATAGATGG - Intronic
1051219666 9:14834772-14834794 ATATATGTTCAAAAATTGTATGG + Intronic
1051348489 9:16174644-16174666 ATATATGTATATAAAATTTAAGG + Intergenic
1051962465 9:22784497-22784519 AGATATGTGAATAAAATGGAAGG - Intergenic
1052003841 9:23322475-23322497 ATATATGTGTATACAATATACGG - Intergenic
1052601796 9:30642552-30642574 ATATAGGTAAATAAAATGCATGG - Intergenic
1054966779 9:71037471-71037493 ATATGTGTGCATATAATATATGG + Intronic
1054987692 9:71281408-71281430 AAATATGTGAATAAAATAGATGG - Intronic
1055015250 9:71609799-71609821 TTATATGTGAATGAAATGAATGG - Intergenic
1055182938 9:73411842-73411864 ATAAATCTACATAAAATGGAAGG - Intergenic
1055360259 9:75482175-75482197 ATATATTTTCATAAAGTGGATGG - Intergenic
1055858275 9:80718104-80718126 AAATATGTGGATAGAATGTAGGG - Intergenic
1056032577 9:82568260-82568282 ATTTATCTGCATAAAAAGGTGGG + Intergenic
1056458736 9:86788806-86788828 ATATATGTCCAGGAAATTGATGG + Intergenic
1056668620 9:88603428-88603450 ATACATGTGCATAATGTGCAGGG - Intergenic
1056850761 9:90081792-90081814 AAAAATGTTCATAACATGGATGG - Intergenic
1058214309 9:102214807-102214829 ATATATGTGTATCAAAGTGATGG - Intergenic
1058241103 9:102561200-102561222 AGGTAAGTGCAAAAAATGGATGG - Intergenic
1058515805 9:105773263-105773285 ATATATGTGGAAAAAATTGGGGG + Intronic
1059304824 9:113345947-113345969 ATATAGGTAAACAAAATGGATGG - Intergenic
1060160899 9:121362379-121362401 AAAAATGTTCATAACATGGATGG - Intronic
1203692718 Un_GL000214v1:60483-60505 AAATATGTTGATAAAATAGAGGG - Intergenic
1203643577 Un_KI270751v1:43708-43730 AAATATGTTGATAAAATAGAGGG + Intergenic
1186222131 X:7360844-7360866 AGAAGTGTGCATACAATGGAGGG + Intergenic
1187537189 X:20152747-20152769 TTATATGTTCACAAAATGGAAGG - Exonic
1188294139 X:28425632-28425654 ATTTATTTAAATAAAATGGAAGG - Intergenic
1188742556 X:33803768-33803790 AAAGATGTCCTTAAAATGGAAGG - Intergenic
1189001508 X:36952479-36952501 ATATATGTTCAAAAATTGTATGG + Intergenic
1189080097 X:37961741-37961763 ATATATTTGTATAATATTGATGG + Intronic
1189111173 X:38291135-38291157 ATATATATATATAAAATGAAGGG + Intronic
1189200626 X:39192928-39192950 ATATATGTGCACAACAGGAAGGG + Intergenic
1189569813 X:42284599-42284621 ATATATGTTCATGAGTTGGAAGG + Intergenic
1190427523 X:50346779-50346801 ATATCTGCGCAGAAAATGGTAGG - Exonic
1190722985 X:53166105-53166127 ATATATGTTCAAAAATTGTATGG + Intergenic
1190901232 X:54675262-54675284 ATATATGTGCTTAACCTAGAAGG - Intergenic
1192352637 X:70370264-70370286 AAATGTCTGCAAAAAATGGAAGG + Intronic
1193249279 X:79269199-79269221 ATATTTCTGGATAAAATTGAAGG + Intergenic
1193253619 X:79321336-79321358 ATATATGTGCACAGACAGGAAGG + Intergenic
1193667536 X:84340544-84340566 ATACATTTTCATAAACTGGAAGG + Intronic
1194098350 X:89671916-89671938 ATACATGTGCAGAACGTGGAGGG + Intergenic
1194131396 X:90086420-90086442 ATATATGTCCAAAAATTGTACGG - Intergenic
1195943823 X:110188529-110188551 AAAAATGTCCAAAAAATGGAGGG + Intergenic
1196257088 X:113533351-113533373 TTATATATACATAAAATAGAAGG + Intergenic
1197019339 X:121668037-121668059 ATATATGTTCTCAAAATTGAAGG - Intergenic
1197923854 X:131626184-131626206 AGATGTGTGAGTAAAATGGAAGG + Intergenic
1198147736 X:133874402-133874424 ATATATGTGCATAAAATGGAAGG - Intronic
1198319747 X:135508574-135508596 GTATATGTGCATAAAATATCTGG - Intergenic
1198401111 X:136269230-136269252 ATATATGTTCATATCATTGATGG - Intergenic
1198409851 X:136355537-136355559 ATATATATATATAACATGGACGG + Intronic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1199006321 X:142701486-142701508 AAATATGTTCATGAAATGTAAGG - Intergenic
1199717875 X:150519190-150519212 AAAGATGTGAATAAAGTGGAAGG + Intergenic
1199757467 X:150878663-150878685 GTATATGTGAATAAAATGCATGG + Intronic
1200451373 Y:3333294-3333316 ATACATGTGCAGAACGTGGAGGG + Intergenic
1201333727 Y:12856430-12856452 ATATCAGTGCATAAAATGTATGG + Exonic
1201476246 Y:14384870-14384892 ATAGATGTGGATAGAATAGATGG + Intergenic
1201786618 Y:17789374-17789396 ATATCAGTGCATAAAATGTGTGG - Intergenic
1201814935 Y:18116614-18116636 ATATCAGTGCATAAAATGTGTGG + Intergenic
1201851412 Y:18486284-18486306 ATATCAGTGCATAAAATGTATGG + Intergenic
1201881907 Y:18834095-18834117 ATATCAGTGCATAAAATGTATGG - Intergenic
1202330133 Y:23741321-23741343 ATATCAGTGCATAAAATGTATGG - Intergenic
1202540637 Y:25928741-25928763 ATATCAGTGCATAAAATGTATGG + Intergenic