ID: 1198155428

View in Genome Browser
Species Human (GRCh38)
Location X:133955251-133955273
Sequence GTCCCCTGTGAGCAAAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198155428_1198155435 25 Left 1198155428 X:133955251-133955273 CCAGGACTTTGCTCACAGGGGAC 0: 1
1: 0
2: 2
3: 15
4: 235
Right 1198155435 X:133955299-133955321 CTTGCCAAACTTTCTTAAAACGG 0: 1
1: 0
2: 2
3: 27
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198155428 Original CRISPR GTCCCCTGTGAGCAAAGTCC TGG (reversed) Intronic
902698154 1:18154235-18154257 GTCCCCTGTAAGGAGAGCCCAGG - Intronic
903296779 1:22348784-22348806 GTCCCTTGGGAGCAAAGGGCTGG - Intergenic
903461085 1:23521471-23521493 GTCCCCTGGGAGCTAAGTAGGGG - Intronic
906612795 1:47214846-47214868 CTCACCTGTGAGCACAGACCAGG + Intergenic
910062630 1:83112069-83112091 GTCTGCTATGAGCAAAGTACTGG - Intergenic
913113876 1:115679413-115679435 AGCCCCTCAGAGCAAAGTCCTGG - Intronic
913144429 1:115976161-115976183 GTCCCCTGTAGGCAGAGCCCTGG + Intergenic
913241293 1:116832190-116832212 GTCTCCTCTGAGCAAACTGCTGG + Intergenic
918730384 1:187985908-187985930 GTCCCCTGTTTTCAAATTCCTGG + Intergenic
919941285 1:202288211-202288233 GTGACATTTGAGCAAAGTCCTGG - Intronic
923617275 1:235548397-235548419 GTCCACTGGTAGCAATGTCCAGG - Exonic
924110006 1:240689754-240689776 GTCTCATGTGATCAAAGTCGGGG - Intergenic
1066076988 10:31888620-31888642 GGCCCATGAGACCAAAGTCCAGG - Intronic
1068428417 10:56898475-56898497 GTCCCCTGTGCACAATGACCTGG + Intergenic
1070532719 10:77351066-77351088 GTCCCCTGAAAGCATTGTCCTGG - Intronic
1071060433 10:81564281-81564303 GTCCCTTCTGAGCAACATCCTGG - Intergenic
1072726113 10:97815238-97815260 CGCCCCTGGGAGCAAAGGCCTGG - Intergenic
1074909925 10:117899092-117899114 GTCCTCAGTGAGCAAGGTCAGGG + Intergenic
1075322730 10:121505147-121505169 GTTCCCTGTGAGAAGAGCCCAGG - Intronic
1076259764 10:129055994-129056016 ATCCCCTGCCAGCCAAGTCCTGG + Intergenic
1076954431 10:133688241-133688263 GTCCCCTGTAGGCAAAGCCTAGG + Intergenic
1077370436 11:2179339-2179361 GTCCCCTGTGAACGCAGCCCAGG - Intergenic
1078215619 11:9309536-9309558 GTCTACTATGAGCAAAGTACTGG - Intronic
1084169800 11:67395651-67395673 GTCCTCCGAGAGCAAAGCCCTGG + Intronic
1085255572 11:75170782-75170804 CTCCCCTGAAAGAAAAGTCCTGG + Intronic
1087776262 11:102259719-102259741 GTCCCCTATGACCAAATTACAGG - Intergenic
1089155559 11:116399391-116399413 GACATCTGTAAGCAAAGTCCTGG + Intergenic
1089650645 11:119910667-119910689 GTCTCCTGTGAGGGACGTCCTGG - Intergenic
1089691670 11:120190693-120190715 GTCCACTGTCTGCAGAGTCCTGG + Intergenic
1091940642 12:4477466-4477488 CTGCCCTGGGAGAAAAGTCCAGG + Intergenic
1091972319 12:4797697-4797719 CACCCCTGTGAGCACATTCCAGG - Intronic
1092231786 12:6779841-6779863 GTCATCTGTGGCCAAAGTCCAGG - Intergenic
1092273472 12:7041341-7041363 GTTCCCTCTGAACAAGGTCCAGG + Intronic
1094592301 12:31833059-31833081 GTCCCTTCTGAGCAACATCCTGG + Intergenic
1095225726 12:39674771-39674793 GACCCCTGTGAGAGAAGGCCAGG - Intronic
1096238094 12:49943340-49943362 GACCCTTGTGAGCAAGGTCCCGG + Intergenic
1100493729 12:95105284-95105306 GCATACTGTGAGCAAAGTCCTGG - Intronic
1100614164 12:96218162-96218184 GCCCCCTGTGACCATGGTCCTGG + Intronic
1105587026 13:21755039-21755061 GTGCCCAGTGACCACAGTCCAGG + Intergenic
1106194772 13:27483773-27483795 GGCCCCTGTGAGGGAAGCCCAGG - Intergenic
1107146826 13:37069536-37069558 GTCCCCTGTGCCCCACGTCCCGG + Intergenic
1108937697 13:55904360-55904382 GTCCCTTCTGAGCAACATCCTGG + Intergenic
1111516992 13:89347016-89347038 GTCTCTTCTGAGCAATGTCCTGG + Intergenic
1111547200 13:89755926-89755948 GTCCCTTCTGAGCAATATCCTGG - Intergenic
1117378089 14:55134024-55134046 ATCCCCTGGGAGCAAAATCATGG - Intronic
1117954551 14:61112538-61112560 GTCACCTGTGCACAAAGGCCGGG - Intergenic
1118651559 14:67901354-67901376 GTCCCTTCTGAGCAACATCCTGG + Intronic
1119850632 14:77864061-77864083 TTCCCCTGGGAGGAAAGACCAGG - Intronic
1121890202 14:97583279-97583301 GACCCCTGTGTACCAAGTCCAGG + Intergenic
1122126417 14:99580997-99581019 GTCCCCAGAGAGCCAAGTGCAGG + Intronic
1202850337 14_GL000225v1_random:13158-13180 GTCCCCTGTAGGCAAAGCCTAGG + Intergenic
1202850597 14_GL000225v1_random:15542-15564 GCCCCCTGTAGGCAAAGCCCAGG + Intergenic
1202853057 14_GL000225v1_random:33324-33346 GTCCCCTGTAGGCAAAGCCTAGG + Intergenic
1202855620 14_GL000225v1_random:49792-49814 GTCCCCTGTAGGCAAAGCCTAGG + Intergenic
1202858761 14_GL000225v1_random:67551-67573 GTCCCCTGTAGGCAAAGCCTAGG - Intergenic
1202860134 14_GL000225v1_random:76434-76456 GTCCCCTGTAGGCAAAGCCTAGG - Intergenic
1202861041 14_GL000225v1_random:81102-81124 GTGCCCTGTAGGCAAAGTCTAGG - Intergenic
1202862918 14_GL000225v1_random:94895-94917 GTCCCCTGTAGGCAAAGCCTAGG - Intergenic
1202863164 14_GL000225v1_random:97350-97372 GTCCCCTGTGGGTAAAGGCTAGG - Intergenic
1202863885 14_GL000225v1_random:103316-103338 GTCCCCTGTAGGCAAAGCCTAGG - Intergenic
1202865853 14_GL000225v1_random:116507-116529 GTCCCCTGTAGGCAAAGCCTAGG - Intergenic
1202865993 14_GL000225v1_random:117730-117752 GTCCCCTGTAGGCAAAGCCTAGG - Intergenic
1202866303 14_GL000225v1_random:120603-120625 GTCCCCTGTAGGCAAAGCCTAGG - Intergenic
1202868492 14_GL000225v1_random:137543-137565 GTCCCCTGTAAGCAAAGCCTAGG - Intergenic
1124630787 15:31335996-31336018 GTCTCCTGTGAGCACAGGCCAGG + Intronic
1127750282 15:62031929-62031951 GTCACCTGTAAGAAAAGTCGTGG - Intronic
1129207764 15:74047217-74047239 ATCACCTGTTACCAAAGTCCTGG - Intronic
1129757326 15:78106241-78106263 GTCCACTGTGGGCTAAGGCCAGG - Intronic
1129871470 15:78944477-78944499 ATCCCCTGTGTGCCAAGTCCCGG + Intronic
1132582105 16:689607-689629 GTCCCGTGTGACCACAGCCCTGG - Exonic
1132671380 16:1103475-1103497 GGCCCCTGTTAGCAGAGCCCGGG + Intergenic
1133121278 16:3610069-3610091 GTCGCCTGTGTGCAAAGGCTGGG + Intronic
1133128465 16:3662128-3662150 GTCACCTGTGAGCAAAGCCCGGG + Exonic
1134067547 16:11238815-11238837 GTTCCCTGAGAGCAAAGCTCTGG + Intergenic
1135886172 16:26310211-26310233 GTCACCAGTGAGTAAAGTTCAGG - Intergenic
1136269029 16:29137706-29137728 GTCCCCTGAGAGCACAGCCAGGG + Intergenic
1137027861 16:35496511-35496533 GTCCCCTGTGGGCAGAACCCAGG + Intergenic
1137034463 16:35557876-35557898 GTCCCCTGTGAGCAGAACCCAGG + Intergenic
1138139929 16:54559443-54559465 GCCCCCTGTGAGCAGAGGCCAGG + Intergenic
1138634991 16:58331292-58331314 CTCCCCTCTGTGCCAAGTCCTGG + Intronic
1139436961 16:66941943-66941965 GACCCCCATGAGCAAAGGCCTGG + Intronic
1139971065 16:70775550-70775572 GTCCCCTCTGAGCTGCGTCCTGG - Intronic
1142072335 16:88098073-88098095 GTCCCCTGAGAGCACAGCCAGGG + Intronic
1142136027 16:88452500-88452522 TTCCCCTGTGAGCTCAGACCAGG - Intergenic
1143276063 17:5711800-5711822 CTCTTCTGTGTGCAAAGTCCTGG + Intergenic
1144734351 17:17546626-17546648 GGCGCCTGTGAGCAGAGGCCTGG - Intronic
1146928805 17:36763641-36763663 GTCCACAGTCAGCAGAGTCCAGG - Intergenic
1149563744 17:57627598-57627620 GTCCCCAGTGAGAAAAAACCCGG - Intronic
1150299502 17:64036588-64036610 GTCACCTGGAAGCAAACTCCAGG + Intergenic
1152965337 18:109331-109353 GTCCCCTGTAGGCAAAGCCTAGG - Intergenic
1156344849 18:36247506-36247528 AACCCCTGTGAGATAAGTCCAGG + Intronic
1156522072 18:37730390-37730412 ATCCCCTGTGGGCCAAGCCCTGG + Intergenic
1157578709 18:48760849-48760871 GCCCCCTGTGGGCACAGCCCTGG - Intronic
1159539406 18:69756128-69756150 GTCCCATATGAGCAATGACCTGG + Intronic
1160018124 18:75159342-75159364 GTGCTCTGGGAGCAAAGCCCAGG - Intergenic
1160875583 19:1294990-1295012 GACCCCTGTGTGCAAAGGGCCGG - Intronic
1161073626 19:2274545-2274567 GTTCCCTGGGGGCAAAGGCCAGG - Intronic
1161272571 19:3398052-3398074 GTCAACTGTGTGCAAAATCCTGG - Intronic
1164041119 19:21493540-21493562 CTCCCCTATGAGCAAAGCCTTGG - Intergenic
1164041128 19:21493611-21493633 GCTCCCTGTGAGCAAAGCTCAGG - Intergenic
1164085918 19:21902358-21902380 CTCCTCTGTGAGCAGAGACCAGG - Intergenic
1164087362 19:21915542-21915564 GCTCCCTGTGAGCAAGGCCCTGG - Intergenic
1164097938 19:22028717-22028739 CTCCCCTGTGGGCAAGGCCCAGG + Intergenic
1164098055 19:22029523-22029545 GCTCCCTGTGAGCAGGGTCCAGG + Intergenic
1164109058 19:22137619-22137641 GCCCCCTGTGAGCAGGGACCAGG - Intergenic
1164117980 19:22240415-22240437 GCTCCCTGTGAGCAGGGTCCAGG + Intergenic
1164120285 19:22259841-22259863 CTCCCATGTGAGCAGAGACCAGG + Intergenic
1164127817 19:22334489-22334511 TGCCCCTGTAAGCAGAGTCCAGG + Intergenic
1164129236 19:22346776-22346798 GCCCCCTGTGGGCAAGGCCCAGG - Intergenic
1164179973 19:22809789-22809811 CTCCCATGTGAGCAGAGACCAGG - Intergenic
1164181841 19:22825980-22826002 GTCCCCTGTGAGCAAGGCTAAGG - Intergenic
1164205139 19:23052267-23052289 TTTCCCTGTAAGCAAAGACCAGG + Intergenic
1164206486 19:23063302-23063324 GCTCCCTGTGAGCAAAGCTCAGG + Intergenic
1164227221 19:23256427-23256449 TTTCCCTGTGAGCAGAGACCAGG + Intergenic
1164234253 19:23318345-23318367 ATCCCCTGTGAGCAGAGATCAGG - Intronic
1164234278 19:23318563-23318585 GCCCCCTGTGGGCAGGGTCCAGG - Intronic
1164234302 19:23318784-23318806 GACCCCTGTGGGCAATGACCAGG - Intronic
1164234675 19:23321983-23322005 ATCCCCTATGGGCAAAGCCCAGG - Intronic
1164242247 19:23399788-23399810 GCCCCCTGTGGGCAGGGTCCAGG + Intergenic
1164249086 19:23461313-23461335 GACCCCTGTGGGCAATGACCAGG - Intergenic
1164260040 19:23561373-23561395 GCTCCCTGTGAGCAAAGCCCAGG + Intronic
1164281925 19:23776826-23776848 GCCCCCTGTGGGCAGGGTCCAGG - Intronic
1164302557 19:23974565-23974587 ATCCCCTATGGGCAAAGCCCAGG + Intergenic
1164302924 19:23977768-23977790 GACCCCTGTGGGCAATGACCAGG + Intergenic
1164302948 19:23977991-23978013 GCCCCCTGTGGGCAGGGTCCAGG + Intergenic
1164417314 19:28057944-28057966 GTCCTCTCTGGGCAAAGCCCAGG - Intergenic
1167905746 19:52659137-52659159 GTCCTGTGTGAGGAAAGTCAGGG + Intronic
925448337 2:3947236-3947258 GTGGCCTGTGAGCAAAATACAGG - Intergenic
928054475 2:28038316-28038338 GTGCTCTGAGAGCAAATTCCAGG - Intronic
929582081 2:43087830-43087852 CTCCCTTGTGAGGAAATTCCAGG - Intergenic
934524614 2:95043856-95043878 ATCCCCTGGGAGCAAACCCCTGG + Intronic
934925023 2:98376283-98376305 TTCTCCTGTGAGCAAGTTCCTGG - Intronic
935135361 2:100295723-100295745 CTCCACTGTGAGAAAAGGCCAGG + Intronic
935977763 2:108595987-108596009 GCCCCCTGAGAGCAAAGATCAGG + Intronic
936135378 2:109888516-109888538 GTCCCCTGAGAGCAAAGATCAGG + Intergenic
936209319 2:110482969-110482991 GTCCCCTGAGAGCAAAGATCAGG - Intergenic
946502845 2:220268147-220268169 GGCACCTGGGAGCAAAGTCATGG - Intergenic
947360788 2:229343373-229343395 GTCTCCAGTAAGCAAAGTCTTGG + Intergenic
948714853 2:239854455-239854477 GTCCCCTGTGAGCTAAGTCTGGG - Intergenic
948853530 2:240719720-240719742 GTCCCCTGTCAGCACAGAGCTGG + Intronic
1170743421 20:19077851-19077873 GTGACCTGTGAGCAGAGACCTGG + Intergenic
1173846859 20:46193741-46193763 GCCCCCTGTGTGCAAAGGCCTGG - Intronic
1174755600 20:53155451-53155473 ATCCCCTTTGGGCAAACTCCAGG + Intronic
1178138982 21:29660328-29660350 GACCCCTATGAGCTACGTCCTGG - Intronic
1179780856 21:43700033-43700055 GACCCCTGTGTGGGAAGTCCTGG + Intergenic
1182718066 22:32376066-32376088 GGGCTCTGGGAGCAAAGTCCTGG - Intronic
1182933149 22:34194189-34194211 CTACCCAGTGATCAAAGTCCAGG - Intergenic
1183978876 22:41528243-41528265 GTCCCCTGAGTGCCAGGTCCTGG - Exonic
1184465001 22:44663775-44663797 GTCCCCTGTCACCATAGTCAGGG - Intergenic
1184692020 22:46121762-46121784 CTCCCCTGGCAGCAAAGGCCTGG - Intergenic
949455357 3:4232431-4232453 GTCCCCTGTGAGCCAAGAGAAGG + Intronic
950106444 3:10391936-10391958 GATCACTGTGAGCAAAGGCCAGG - Intronic
951844837 3:27074091-27074113 GGCCACTGTGAGCAATGTCCTGG + Intergenic
953787658 3:45922846-45922868 ATCCTCTCTGAGCAAGGTCCTGG - Intronic
953843697 3:46410159-46410181 GTCCCCTGGCAGCAAGGCCCTGG - Intronic
957374932 3:79343780-79343802 GTGTCCTTTGAGCAAAGTCTGGG + Intronic
957891754 3:86367962-86367984 GGCACCTGTGAGAAATGTCCAGG + Intergenic
960936071 3:122903436-122903458 GGCCCCAGTGAGCACAGGCCTGG + Intergenic
961374830 3:126457191-126457213 GTCCCCTGTGGCCGCAGTCCTGG - Intronic
961606423 3:128098845-128098867 GTGCCCTGTGAGCAAGGGGCAGG - Intronic
964795443 3:160491779-160491801 TTCCTCTGTGAGCAATGTCAGGG - Intergenic
966440568 3:179940178-179940200 CTTCCCTGTCTGCAAAGTCCAGG - Intronic
968393342 4:211239-211261 GTCCCATCTGAGCAACATCCTGG - Intergenic
968933330 4:3596057-3596079 GCCACCTATGAGCAAAGTACAGG - Intergenic
969468309 4:7370798-7370820 GGCCCCTGTGTGCAAAGGCAGGG - Intronic
970211874 4:13718254-13718276 GCCCTCTGTGAGCAAAGAGCAGG + Intergenic
970445870 4:16122952-16122974 GTCCCTTCTGAGCAACATCCTGG + Intergenic
970742770 4:19257008-19257030 GTCACCTGTGACCAAGTTCCAGG - Intergenic
976811464 4:89105104-89105126 GTCCCCTGTGAGCACAGAGAAGG + Intronic
978450599 4:108828885-108828907 TTCCCGTGTGAGCAAATTTCAGG + Intronic
980315358 4:131192492-131192514 GTCCCTTCTGAGCAATGTCCTGG + Intergenic
981781031 4:148429058-148429080 GAGCTCTGTGAGCAAAATCCTGG - Intronic
984803022 4:183731852-183731874 GTCCCACGACAGCAAAGTCCTGG + Intergenic
985149741 4:186934494-186934516 CTCCCCTGTGAGCACTGTCAGGG + Intergenic
985464118 4:190178353-190178375 GTCCCCTGTAGGCAAAGCCTAGG + Intronic
985975672 5:3417616-3417638 GTTCCCAGTGAGGAAAGTCAAGG + Intergenic
987620796 5:20336771-20336793 GTCCCTTCTGAGCAACATCCTGG - Intronic
996141436 5:119913836-119913858 GACCCCTGTGAGAAAAGGCCAGG + Intergenic
998174273 5:139892052-139892074 ATTGCCTGTGAGCAAAGACCAGG - Intronic
998879369 5:146631089-146631111 GTTCCCTGTAAGCACAGCCCAGG - Intronic
1001133870 5:169086115-169086137 GGCCCCTGTGAGAACAGTCAAGG + Intronic
1001442085 5:171750820-171750842 GCCTGCTGTGAGCAAAGGCCTGG - Intergenic
1001583474 5:172816645-172816667 GTCCTCTTTGAGCAAAGACATGG + Intergenic
1006508493 6:34506962-34506984 CTCCCCTGTGAGGAAAGGCCGGG - Intronic
1007022279 6:38532639-38532661 GTCATCTGAGAGCTAAGTCCTGG - Intronic
1007810893 6:44485003-44485025 GTCCCCTAGGTGGAAAGTCCTGG - Intergenic
1007932772 6:45707426-45707448 GCCACCAGTGAGCAAAGTACAGG + Intergenic
1010331711 6:74630539-74630561 TTCCCCTGTGGGCAAAGTAAAGG - Intergenic
1010801956 6:80186718-80186740 GACCCCTGTGAGATAAGTCAGGG + Intronic
1012508859 6:99979293-99979315 GCCCTCAGTGAGCAAAGTGCAGG - Intronic
1016321025 6:142846024-142846046 ATCCAGTGTGAGCGAAGTCCAGG + Intronic
1018248688 6:161846540-161846562 GTCCCCAGTGAGGAAAATACAGG + Intronic
1019717653 7:2547407-2547429 GTCCCATGTGCTGAAAGTCCAGG - Exonic
1020084106 7:5301421-5301443 GTGACTTGTGAGCAAAGACCTGG + Intronic
1022957230 7:35392200-35392222 TTCCTCTGTGTGCATAGTCCAGG + Intergenic
1025715732 7:63953599-63953621 GTCCCCTGGGATCACATTCCAGG - Intergenic
1025722141 7:64026769-64026791 GTCCCCTGTGGGAGAGGTCCAGG + Intergenic
1025750869 7:64293091-64293113 GTCCCCTGTGGGAGAGGTCCCGG + Intergenic
1025759003 7:64372858-64372880 GTCCCCTGTGAGCAGGGCACTGG - Intergenic
1025781254 7:64603727-64603749 CCCCCCTGTGAGCAGAGACCTGG - Intergenic
1025785108 7:64636884-64636906 GTCCCCTGTGGACAGAGTTCAGG - Intergenic
1025785172 7:64637359-64637381 GTACCCTGTGGGCAAAACCCAGG + Intergenic
1025785422 7:64639406-64639428 ACCCGCTGTGAGCAAAGACCAGG - Intergenic
1026036361 7:66833044-66833066 GACACCTGTCAGCCAAGTCCAGG + Intergenic
1026037436 7:66839956-66839978 GACACCTGTCAGCCAAGTCCAGG + Intergenic
1026983125 7:74538092-74538114 GACACCTGTCAGCCAAGTCCAGG - Intronic
1027214234 7:76173695-76173717 GACACCTGTCAGCCAAGTCCAGG - Intergenic
1027733394 7:81903582-81903604 GACCTCTGTGAGAAAAGGCCAGG + Intergenic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1030394908 7:108973815-108973837 GTCAGCTGTGACCAAAATCCAGG - Intergenic
1035054983 7:156029177-156029199 GTCCCACGTGAGCAGAGGCCAGG - Intergenic
1040358439 8:46642025-46642047 GTCCCCTGTGGGGAGCGTCCAGG - Intergenic
1040371343 8:46778854-46778876 GTCCCTTGTCAGCAGTGTCCAGG - Intergenic
1040376042 8:46825622-46825644 GTCCCCTGTGGGCAAGGCACTGG - Intergenic
1046017583 8:108623769-108623791 GTCCCATGAGAGAAAAATCCAGG - Intronic
1047384444 8:124396123-124396145 GTCCCCTGTGAGGTAGGTTCAGG + Intergenic
1048481849 8:134804117-134804139 GTCATCTGTGAGAAAAGCCCTGG + Intergenic
1050253372 9:3769277-3769299 GCCCGTTGTGGGCAAAGTCCTGG - Intergenic
1052995553 9:34550067-34550089 GACCCCTGAAAGCAAAGGCCTGG - Intergenic
1053253436 9:36594741-36594763 GGTCCCTGTGAGCATAGCCCTGG - Exonic
1057763252 9:97893051-97893073 GTCCTCTGTGACCAAACTCAGGG - Intergenic
1061929084 9:133823021-133823043 GTCCCCTGAGAGCCAGGCCCTGG - Intronic
1062630110 9:137459554-137459576 GCCCCCTGGTCGCAAAGTCCTGG + Intergenic
1203736281 Un_GL000216v2:142715-142737 GTCCCCTGTAAGCAAAGCCTAGG + Intergenic
1203738037 Un_GL000216v2:155621-155643 GTCCCCTGTAGGCAAAGCCTAGG + Intergenic
1203738481 Un_GL000216v2:159651-159673 GTCCCCTGTAGGCAAAGCCTAGG + Intergenic
1203740435 Un_GL000216v2:172697-172719 GTCCCCTGTAGGCAAAGCCTAGG + Intergenic
1185591860 X:1282613-1282635 GTCCCCTGCCAGGAATGTCCTGG + Intronic
1185633145 X:1531426-1531448 GTCCCCCGTAAACAATGTCCAGG + Intronic
1191023663 X:55889778-55889800 GGACCCTGTGAGCCAAGTGCGGG + Intergenic
1194626288 X:96230019-96230041 GTCATCTGGGAGCAAGGTCCTGG - Intergenic
1194839823 X:98726568-98726590 GTCCTCTGGGAGCAAGGGCCTGG + Intergenic
1198155428 X:133955251-133955273 GTCCCCTGTGAGCAAAGTCCTGG - Intronic
1198393091 X:136196146-136196168 GTCCCCTGTGCCCAGAGTCATGG - Intronic
1198586094 X:138124040-138124062 GTCACCTGGGAGCTAAGGCCTGG + Intergenic
1199032202 X:143013726-143013748 GTCATCTGGGAGCTAAGTCCTGG - Intergenic
1199609249 X:149599329-149599351 GTGCACTGCGAGAAAAGTCCCGG + Intronic
1199629869 X:149770026-149770048 GTGCACTGCGAGAAAAGTCCCGG - Intergenic
1199894333 X:152116964-152116986 GTCCCCTCTGAGCAAAAATCAGG + Intergenic
1200849770 Y:7871075-7871097 GTCCCCTGTGGGCAGTGTCTAGG + Intergenic
1200859321 Y:7973555-7973577 GTCCCCTGTGAGCAGGGCACTGG + Intergenic
1200865283 Y:8036931-8036953 GTCCCTTGTGGGCAGTGTCCAGG - Intergenic
1200890333 Y:8316851-8316873 GTCCCCTGTGGGCAGGGCCCTGG - Intergenic
1200894040 Y:8355663-8355685 GTCCCTTGTGGGCAGTGTCCAGG + Intergenic
1200904844 Y:8471307-8471329 GTCCTTTGTGGGCAATGTCCAGG - Intergenic
1200907140 Y:8495406-8495428 GTCACCTGTGAGCAAGGCACTGG - Intergenic
1201125923 Y:10914126-10914148 GGCCCCTGTAGGCAGAGTCCAGG - Intergenic
1201178753 Y:11326189-11326211 GTCCCCTGTAGGCAAAGCCTAGG + Intergenic
1202263622 Y:22995419-22995441 GTCTCCTCTGGGCAAAGTACTGG - Intronic
1202416612 Y:24629160-24629182 GTCTCCTCTGGGCAAAGTACTGG - Intronic
1202454175 Y:25040926-25040948 GTCTCCTCTGGGCAAAGTACTGG + Intronic
1202624005 Y:56838982-56839004 GTCCCCTGTAGGCAAAGCCTAGG - Intergenic
1202624535 Y:56843822-56843844 GTCCCCTGTAGGCAAAGCCTAGG - Intergenic