ID: 1198157038

View in Genome Browser
Species Human (GRCh38)
Location X:133971251-133971273
Sequence CTTTCTATACAGATAGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198157038_1198157039 7 Left 1198157038 X:133971251-133971273 CCTTGTTCTATCTGTATAGAAAG 0: 1
1: 0
2: 1
3: 13
4: 204
Right 1198157039 X:133971281-133971303 AATACTCAGTTCTTAGAAAATGG 0: 1
1: 0
2: 2
3: 32
4: 357
1198157038_1198157040 23 Left 1198157038 X:133971251-133971273 CCTTGTTCTATCTGTATAGAAAG 0: 1
1: 0
2: 1
3: 13
4: 204
Right 1198157040 X:133971297-133971319 AAAATGGAATGTAAATTCATTGG 0: 1
1: 0
2: 3
3: 48
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198157038 Original CRISPR CTTTCTATACAGATAGAACA AGG (reversed) Intronic
900751204 1:4398949-4398971 CTTTCCCTGCAGAAAGAACATGG + Intergenic
900853775 1:5164486-5164508 CTATCTATAAAGACAGAGCAGGG - Intergenic
904350221 1:29900338-29900360 CTCTCTACAAAGACAGAACACGG + Intergenic
904787571 1:32994164-32994186 TTTTCTAGTCAGATAGAACAGGG + Intergenic
908934695 1:69360488-69360510 GTTTGCATACAGACAGAACAGGG - Intergenic
909546079 1:76848525-76848547 CTTTTTATAAAAATAGAAGAGGG - Intergenic
911960697 1:104298486-104298508 CTTTTTAAACAGAAAGGACATGG + Intergenic
914049697 1:144121201-144121223 CTTTCTGTACACATAAACCAAGG + Intergenic
914129485 1:144844250-144844272 CTTTCTGTACACATAAACCAAGG - Intergenic
915141310 1:153770352-153770374 CTTCCTATACAGTTAGGGCAAGG + Intronic
917830792 1:178883467-178883489 CTTTCATTAAAGATAGAACCAGG + Exonic
918146499 1:181760759-181760781 CTTTGAAGTCAGATAGAACAGGG - Intronic
918600513 1:186353492-186353514 GTTTCTATTAAGATAGAAGAGGG - Intronic
919420795 1:197367801-197367823 CTTTCCATACAGAGAGCAGATGG - Intronic
924800146 1:247323476-247323498 CTTTGTTTCCAGATATAACAAGG + Intronic
1063779678 10:9307048-9307070 ATTTATATGCAGATAGACCAAGG - Intergenic
1064243511 10:13651405-13651427 CTTTGAATGTAGATAGAACATGG + Intronic
1067352773 10:45491792-45491814 CTTTCTGTACAGATAATCCAAGG - Intronic
1068039896 10:51810411-51810433 CTTTGTATACAGATGCTACAAGG - Intronic
1072982382 10:100110172-100110194 CTTTATAATCAGATAGAACTTGG - Intergenic
1073822790 10:107284110-107284132 TTTTCTATACAGAGAGAAAATGG + Intergenic
1076325725 10:129620399-129620421 CTTTCTCGACTGATTGAACAGGG - Intronic
1080366676 11:31582052-31582074 CTTTCTAAAGACATAGAAAATGG - Intronic
1081089391 11:38844531-38844553 CTCTCTAAACAGAGAGAGCAGGG - Intergenic
1085395027 11:76202824-76202846 CTATCTATACAGTGAGGACAAGG - Intronic
1085964842 11:81510298-81510320 CTTTCTTTACCTACAGAACAAGG - Intergenic
1086484065 11:87278077-87278099 AATTCTATACAGGTAGAGCAAGG - Intronic
1090435395 11:126682875-126682897 TTTTCTATCCTCATAGAACAGGG - Intronic
1090841554 11:130493115-130493137 CTTTCAAAACAGAAAGAACCAGG - Intergenic
1091422559 12:355078-355100 CTTTCTATCCTGATATATCATGG - Intronic
1091915917 12:4271872-4271894 CTTTCTTTACATATAGGAGATGG + Intergenic
1092095057 12:5834845-5834867 CTTTCCATATAGATAGAACTAGG + Intronic
1094073215 12:26442597-26442619 ATTTCTATACAAATAGAAATAGG - Intronic
1094466749 12:30761792-30761814 CAATCTATAGAGACAGAACATGG + Intergenic
1095887865 12:47207488-47207510 CTTTCTCTCCTGATAGGACAAGG + Intronic
1096755163 12:53793379-53793401 CTTTTTAAGCAGATGGAACAGGG + Intergenic
1098065520 12:66611918-66611940 CTTTTTGTAGAGAGAGAACATGG + Intronic
1098627160 12:72686014-72686036 GTTTGAATACAGAGAGAACAGGG + Intergenic
1100680577 12:96915776-96915798 CATTCTATAAAGATGGAGCATGG + Intronic
1103501578 12:121407100-121407122 CTTTCTAAACTGTTAGAAAAAGG + Intronic
1104245299 12:127034521-127034543 CTTTCTTTTCAGAGAGAAAAGGG - Intergenic
1104271627 12:127287625-127287647 GTTTCTGTACAGTTTGAACACGG + Intergenic
1107093109 13:36504554-36504576 AATTCTATAGAGAGAGAACATGG - Intergenic
1107197566 13:37671419-37671441 CATACCATACAGATTGAACATGG + Intronic
1107380958 13:39856104-39856126 CTTTCTATAAGGAAAGAAAAAGG + Intergenic
1108257492 13:48624676-48624698 CTATCTGTCCAAATAGAACAAGG + Intergenic
1111319649 13:86610180-86610202 CTTTATAGACAGATAGATGATGG - Intergenic
1111400287 13:87724873-87724895 CTTTCTATATCCATAGAATAAGG + Intergenic
1111463994 13:88583803-88583825 CTTTCTTTACAGATTGTCCAAGG - Intergenic
1111579918 13:90209473-90209495 CCTTGTATCCAGATATAACACGG - Intergenic
1112798128 13:103079772-103079794 CATTCTATACAAATGGAAAATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116214939 14:42003179-42003201 CTTTATATTCAGACAGAACTAGG + Intergenic
1116224921 14:42137952-42137974 CTGTCTCAACAGACAGAACAAGG + Intergenic
1118876288 14:69787519-69787541 ATTTCTATAAAGATGGAATATGG + Intronic
1119686986 14:76640805-76640827 CTTTCCAGGCAGACAGAACAGGG - Intergenic
1121041513 14:90752776-90752798 CTTTGTAGTCAGATAGACCAGGG - Intronic
1121285967 14:92736095-92736117 ATTACTCTACAGACAGAACAGGG + Intronic
1122381968 14:101314134-101314156 CTTTTTAAACAGGTAAAACAAGG - Intergenic
1123419564 15:20120423-20120445 CTTTCTGTACATATAAACCAAGG + Intergenic
1123446299 15:20333089-20333111 CTTTCTGTACACATAAACCAAGG - Intergenic
1123528786 15:21126961-21126983 CTTTCTGTACACATAAACCAAGG + Intergenic
1123904589 15:24909132-24909154 CTCTCAATACATAAAGAACAGGG - Intronic
1126141955 15:45446129-45446151 CTTCCTTTACAGGGAGAACAGGG + Intronic
1127422122 15:58816640-58816662 ATCACTATACAGATAGAACTAGG + Intronic
1127688740 15:61374026-61374048 ATTTCTCTCCAGAAAGAACAAGG - Intergenic
1128411811 15:67406782-67406804 CTCTCTTTACAGATAGAGAAAGG - Intronic
1131059088 15:89393402-89393424 CTTTCCATGATGATAGAACATGG - Intergenic
1131875221 15:96798782-96798804 ATTGCTATACAGATGAAACATGG + Intergenic
1132160827 15:99540396-99540418 CTATCTATACACATATATCAGGG + Intergenic
1134529010 16:14967937-14967959 CTTGCTGTACAGAAAGACCAAGG + Intergenic
1137228955 16:46543537-46543559 CATCATATACAGATAGAACCAGG + Intergenic
1138708139 16:58938873-58938895 CTTTTTAAACAGAGCGAACATGG + Intergenic
1139033123 16:62909970-62909992 CTTTTTAAACAGTTATAACATGG - Intergenic
1139207619 16:65044541-65044563 CTCTCTATACAGAAGGAAAAAGG + Intronic
1139867354 16:70073041-70073063 CTTGCTGTACAGAAAGACCAAGG - Intergenic
1140997383 16:80274386-80274408 CTTTATAAACAGAGAGAAAAGGG - Intergenic
1145025655 17:19466119-19466141 CTTTTTATACAGATATGGCAAGG + Intergenic
1148288866 17:46423054-46423076 CTTTCTCTACAGATTGAAGTAGG + Intergenic
1148311035 17:46640631-46640653 CTTTCTCTACAGATTGAAGTAGG + Exonic
1148406199 17:47419028-47419050 CATCATATACAGATAGAACCAGG - Intronic
1156712556 18:39964349-39964371 CTTTCTATACATATACACTAAGG - Intergenic
1156884665 18:42121019-42121041 GTCTCTAGACAGATAGAAAATGG - Intergenic
1159691225 18:71490753-71490775 ATTTGTGTACATATAGAACATGG - Intergenic
1166412201 19:42563047-42563069 CTTTATATCCAGATAGACCTGGG + Intergenic
1202689087 1_KI270712v1_random:73764-73786 CTTTCTGTACACATAAACCAAGG + Intergenic
926493849 2:13559244-13559266 AATTCTCTATAGATAGAACATGG + Intergenic
927444569 2:23147593-23147615 CTTCTTATACACATAAAACATGG + Intergenic
928734210 2:34266998-34267020 CTTTCTCTACCTTTAGAACAAGG + Intergenic
933084257 2:78035490-78035512 CTTTCTTTAAAAATAAAACATGG + Intergenic
933957351 2:87382337-87382359 CTTTCTGTACACATAAACCAAGG - Intergenic
934241468 2:90274233-90274255 CTTTCTGTACACATAAACCAAGG - Intergenic
934271706 2:91542451-91542473 CTTTCTGTACACATAAACCAAGG + Intergenic
934621459 2:95811565-95811587 CTCTCTAAGCAGAGAGAACAGGG + Intergenic
934811984 2:97287250-97287272 CTCTCTAAGCAGAGAGAACAGGG - Intergenic
934825709 2:97420677-97420699 CTCTCTAAGCAGAGAGAACAGGG + Intergenic
936069985 2:109361438-109361460 CTTTCAAAACAGAAAGAACCAGG - Intronic
936147702 2:109992076-109992098 CTTCCTATACACATAAACCAAGG + Intergenic
936196990 2:110379365-110379387 CTTCCTATACACATAAACCAAGG - Intergenic
939569929 2:143829162-143829184 ATTTCCATACAGATGGAAAAGGG + Intergenic
939651286 2:144765669-144765691 CTTTATAGACAGATAGAGCTTGG - Intergenic
939816635 2:146904853-146904875 CATTCTCTACACATAGCACAGGG + Intergenic
939972227 2:148675536-148675558 CATTTTATACAGATAGAAGAGGG - Intronic
941435495 2:165465967-165465989 CTTTATATACACCCAGAACAAGG - Intergenic
944050551 2:195463804-195463826 ATCTCTATCCAGATAGAGCACGG + Intergenic
944265514 2:197721029-197721051 CTTTTTATACTGATAAAACTTGG - Intronic
945034483 2:205692724-205692746 CTTACCAAGCAGATAGAACAGGG + Intronic
945042582 2:205754700-205754722 CTTTACATTCAGATAAAACATGG - Intronic
946799299 2:223393090-223393112 CTTTCTAAGCAGACAGAAAAAGG + Intergenic
947454993 2:230245874-230245896 CTTGCTATACAAATAGATGAAGG + Exonic
1169926676 20:10791516-10791538 TTTTCTATGCAGTGAGAACAAGG - Intergenic
1169988356 20:11472053-11472075 TTTTCTTCACAGAAAGAACAAGG + Intergenic
1170723923 20:18908794-18908816 CTTTCTATCCAGACAGAGGAAGG - Intergenic
1172877173 20:38171575-38171597 CATTCTGTGCAGATAGAGCAGGG + Intergenic
1173452840 20:43180401-43180423 CTTTCTATATATATATGACAGGG - Intronic
1174136595 20:48384508-48384530 CTTTCTGTACAGATGAAACCTGG + Intergenic
1176312757 21:5162227-5162249 ATTTCAATACAGATAGAACCAGG + Intergenic
1176312770 21:5162305-5162327 ATTTCAATACAGCTAGAACCAGG + Intergenic
1176312783 21:5162383-5162405 ATTTCAATACAGATAGAACCAGG + Intergenic
1176312794 21:5162461-5162483 ATTTCAATACAGATAGAACCAGG + Intergenic
1178578142 21:33813657-33813679 CTTTCTACAGTGAAAGAACAAGG - Intronic
1179844254 21:44099569-44099591 ATTTCAATACAGATAGAACCAGG - Intronic
1179844265 21:44099647-44099669 ATTTCAATACAGATAGAACCAGG - Intronic
1179844278 21:44099725-44099747 ATTTCAATACAGCTAGAACCAGG - Intronic
1179844291 21:44099803-44099825 ATTTCAATACAGATAGAACCAGG - Intronic
1181351690 22:22263184-22263206 CTTTCTGTACACATAAACCAAGG + Intergenic
1184056356 22:42052891-42052913 CTTTCTGTACAAATAACACATGG - Intronic
1185243282 22:49758296-49758318 CTCTCAATACATAAAGAACAGGG - Intergenic
955388717 3:58502160-58502182 CTTTCTATGCATATAAATCAAGG + Exonic
956496128 3:69828049-69828071 CTTTCTATACAGTTGGCCCAAGG + Intronic
957955075 3:87176005-87176027 CTGGTTATACAGATAGAAAATGG - Intergenic
961937120 3:130596955-130596977 CTTTCTATACGTATACAACTGGG - Intronic
963402856 3:144823365-144823387 TTTTCAAACCAGATAGAACATGG - Intergenic
965147936 3:164930004-164930026 ATTTTTCTACAGATAGAACTTGG + Intergenic
965223086 3:165952870-165952892 CGTCTTATACAGAGAGAACAGGG + Intergenic
966101380 3:176272981-176273003 ATTTTTATATAAATAGAACATGG + Intergenic
966243321 3:177778725-177778747 CATTCTCTACTGAAAGAACAAGG + Intergenic
966721804 3:183070804-183070826 GTTTCTATTCACATAGAAAATGG + Intronic
967644391 3:191903695-191903717 CATTATATACTGAGAGAACAGGG - Intergenic
970287843 4:14538171-14538193 CTTATTATACAGACAGAAAATGG - Intergenic
971237370 4:24854831-24854853 CATTCTAAACAGAGAGAATAGGG - Intronic
971626044 4:28921513-28921535 ATTTCTATCCAGATAGAGAAAGG + Intergenic
971808525 4:31393423-31393445 CTTTTTAAACAAATAGAACTTGG + Intergenic
972204577 4:36756762-36756784 GTTTCTATACATATAAAATATGG + Intergenic
975182391 4:71362083-71362105 CTTTCTACAAAGGTAGAAAAAGG - Intronic
975624604 4:76332481-76332503 TTTTCTATACAGAGAGGATAGGG - Exonic
977111262 4:92958797-92958819 CTTTCCAAACAGAAAGTACAAGG - Intronic
977117308 4:93046480-93046502 CTTTTTATATACATACAACAAGG - Intronic
977740641 4:100476847-100476869 TTTTCTATTCAAATATAACAGGG + Intronic
978552425 4:109941688-109941710 GATTTTATACAGATAAAACAGGG - Intronic
979425151 4:120554703-120554725 CTTTCAATATATATATAACACGG - Intergenic
980242809 4:130200392-130200414 CTTTCTATACTGATCCAAAAAGG - Intergenic
980965696 4:139518561-139518583 CTTTTTTTTCATATAGAACAAGG - Intronic
982635384 4:157889236-157889258 CTTTGTATTTAGATAGAACTGGG - Intergenic
983725968 4:170926306-170926328 ATTTATATACATATAGAACAAGG + Intergenic
984510244 4:180670152-180670174 CTCTCTACACACATACAACAAGG - Intergenic
984883180 4:184428248-184428270 CTTTCTTTAAACAGAGAACATGG + Intronic
985650868 5:1106789-1106811 CTTTCTACACAGGAAGAAAATGG - Intronic
986593620 5:9397023-9397045 AGTTCTATACAAATGGAACAAGG + Intronic
987651410 5:20745062-20745084 CTTTCAATGAGGATAGAACAAGG + Intergenic
988008369 5:25449389-25449411 GTTTCTATACAGGTAGCGCAGGG + Intergenic
989684615 5:44070819-44070841 CTTTCAATAGAGAGATAACAAGG + Intergenic
990173647 5:53083101-53083123 CTATCTATACAGACAGGAAATGG + Intronic
990277882 5:54218236-54218258 CTTTCTATTCAAAAAGAGCATGG + Intronic
991347709 5:65687569-65687591 CTTTCTATAGTGGTAGAAAAAGG - Intronic
991484652 5:67122184-67122206 CTTTATATACAAATAGAATTGGG - Intronic
992328343 5:75686428-75686450 TTTTCTATACAGATAGTCTAAGG - Intronic
992544621 5:77800009-77800031 CTTTCAAAACAGAAAGCACAAGG + Intronic
994131529 5:96234643-96234665 ATTTCTATGCAGAAAGAAAAGGG + Intergenic
994949204 5:106435313-106435335 CTGTCTTTACAGAAAGAAGAAGG - Intergenic
995637579 5:114211764-114211786 TTTTCTATATAGACAGAAAAAGG + Intergenic
996184113 5:120455785-120455807 CTTTCTATACAGAATAATCAAGG + Intergenic
996627748 5:125589750-125589772 CTATCTATATATATAAAACATGG - Intergenic
998242300 5:140457969-140457991 CTGTCTATGCAGATAGGCCATGG + Intronic
999399935 5:151256940-151256962 GTTTGTATACAGAAAGCACAGGG - Intronic
1001797768 5:174516191-174516213 CTATCTATACATATACAACAGGG - Intergenic
1004089552 6:12487168-12487190 CTTTCAATTCTGTTAGAACAGGG + Intergenic
1006243978 6:32713528-32713550 CTTTCTGTACAGATTGCAAAGGG - Intergenic
1007147966 6:39656422-39656444 TTTTCTATACACATATAACTGGG + Intronic
1009583920 6:65571736-65571758 CTTTCTATATAGACTGAACTTGG - Intronic
1011651492 6:89510425-89510447 CTTTATATACAGAAAGCACCTGG + Intronic
1015083745 6:129262269-129262291 CTCCCTAAACAGATAGGACAGGG - Intronic
1015328709 6:131952386-131952408 GTTTATATCCAGATACAACAGGG - Intergenic
1015442257 6:133262779-133262801 CTGTCTATAAAGATAGAACATGG - Intronic
1016821516 6:148350357-148350379 CTCTCTATACTGATAGAATGTGG + Intronic
1016930063 6:149396555-149396577 CTTTTTATAAAGAAACAACATGG - Intronic
1017556560 6:155577694-155577716 CTTCCAATACAACTAGAACATGG - Intergenic
1018153179 6:160959706-160959728 CTTCCTATCCAGCTAGCACAAGG + Intergenic
1020818202 7:12932128-12932150 TTTTCTATAGAGATACAATACGG - Intergenic
1021325254 7:19258529-19258551 CTATCTATTGAGATAGAAAAAGG - Intergenic
1022400363 7:30030320-30030342 CTTTCTATATAGAAAGGAGAAGG - Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1026503408 7:70961948-70961970 CTTCCTTCACAGACAGAACACGG - Intergenic
1028002992 7:85524813-85524835 CTTTCAAAACAGATAGTAAAAGG - Intergenic
1028399442 7:90408696-90408718 CTATCTATACAGAGTCAACAAGG - Intronic
1029007172 7:97222841-97222863 CTTTCTATACAGGAGGAAAATGG - Intergenic
1029913936 7:104186749-104186771 TTTTCTCTATATATAGAACATGG - Intronic
1030992605 7:116318457-116318479 GTATCTATACAAATAAAACATGG - Intronic
1035472373 7:159118666-159118688 CTTTCTATAATGAAAGAACTTGG - Intronic
1038900343 8:31835307-31835329 CATTCTGTAAAAATAGAACATGG + Intronic
1039623196 8:39020317-39020339 TGTTATATACAGATAGAAAATGG + Intronic
1041526961 8:58817052-58817074 CTTTCTATAATGACAGAACGTGG - Intronic
1041693569 8:60713941-60713963 CTTTCTACAAAGAAAGAAAACGG - Intronic
1041753752 8:61290053-61290075 CATTCTTTACAGACAGAAAAGGG - Intronic
1043888894 8:85634251-85634273 CTGTCTTAACAGATAAAACAAGG + Intergenic
1047182657 8:122604310-122604332 CTTTGTGTACAGATTGATCATGG - Intergenic
1048409035 8:134152479-134152501 CTTACTAAACAAATAGAAAAGGG - Intergenic
1052024796 9:23562572-23562594 CTTTATATTAAGATATAACAAGG + Intergenic
1052299313 9:26935672-26935694 GTTTCTACATAGCTAGAACAGGG + Intronic
1058340137 9:103885580-103885602 CTTTCTATCCAGACAGAATGGGG - Intergenic
1059122776 9:111657317-111657339 CTTTATAACCGGATAGAACAAGG + Intronic
1186428270 X:9482703-9482725 CTGGCTATAGAGATAGAAAAAGG - Intronic
1186694911 X:12019963-12019985 GTTTCTATATACATAAAACAAGG - Intergenic
1189731379 X:44024632-44024654 ATTTCTATAAAGATAGAATTAGG - Intergenic
1190010967 X:46784405-46784427 CTTTTTATAAAGATAGATTATGG - Intergenic
1191031582 X:55979540-55979562 TTATCTATAAAGATAGTACAAGG - Intergenic
1193993958 X:88342569-88342591 TTAGCTATACAGATAGAAAATGG + Intergenic
1193998640 X:88399334-88399356 ATTTCTAAACAGGTAGAATAAGG + Intergenic
1198157038 X:133971251-133971273 CTTTCTATACAGATAGAACAAGG - Intronic