ID: 1198157186

View in Genome Browser
Species Human (GRCh38)
Location X:133972780-133972802
Sequence CTGGTGATGGTATCTCTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 154}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198157186_1198157193 17 Left 1198157186 X:133972780-133972802 CCAGACAGAGATACCATCACCAG 0: 1
1: 0
2: 2
3: 18
4: 154
Right 1198157193 X:133972820-133972842 GAGAGGCAGGTTTGTGTGGATGG 0: 1
1: 0
2: 3
3: 42
4: 359
1198157186_1198157191 4 Left 1198157186 X:133972780-133972802 CCAGACAGAGATACCATCACCAG 0: 1
1: 0
2: 2
3: 18
4: 154
Right 1198157191 X:133972807-133972829 ATAGAACGTTAAGGAGAGGCAGG 0: 1
1: 0
2: 1
3: 18
4: 194
1198157186_1198157194 18 Left 1198157186 X:133972780-133972802 CCAGACAGAGATACCATCACCAG 0: 1
1: 0
2: 2
3: 18
4: 154
Right 1198157194 X:133972821-133972843 AGAGGCAGGTTTGTGTGGATGGG 0: 1
1: 0
2: 0
3: 34
4: 241
1198157186_1198157188 -5 Left 1198157186 X:133972780-133972802 CCAGACAGAGATACCATCACCAG 0: 1
1: 0
2: 2
3: 18
4: 154
Right 1198157188 X:133972798-133972820 ACCAGAAATATAGAACGTTAAGG 0: 1
1: 0
2: 0
3: 6
4: 117
1198157186_1198157190 0 Left 1198157186 X:133972780-133972802 CCAGACAGAGATACCATCACCAG 0: 1
1: 0
2: 2
3: 18
4: 154
Right 1198157190 X:133972803-133972825 AAATATAGAACGTTAAGGAGAGG 0: 1
1: 0
2: 2
3: 9
4: 177
1198157186_1198157192 13 Left 1198157186 X:133972780-133972802 CCAGACAGAGATACCATCACCAG 0: 1
1: 0
2: 2
3: 18
4: 154
Right 1198157192 X:133972816-133972838 TAAGGAGAGGCAGGTTTGTGTGG 0: 1
1: 0
2: 1
3: 24
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198157186 Original CRISPR CTGGTGATGGTATCTCTGTC TGG (reversed) Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900495962 1:2976349-2976371 CTGGGGCTGGTATCTCTACCTGG + Intergenic
903529408 1:24018668-24018690 CGGGTACTGGAATCTCTGTCTGG + Intergenic
903922545 1:26810705-26810727 CTGGTGCTGGTGTCTCTGAGTGG - Intergenic
905236922 1:36556339-36556361 CTGGTGATGTTATCTCACTCTGG - Intergenic
909195954 1:72623561-72623583 CTGGTTCTGGTGTCTCTGACAGG - Intergenic
909270750 1:73620605-73620627 CTGATGATTGTATTTCTGTGGGG - Intergenic
910178758 1:84458958-84458980 ATGGTGATGGTGTCTCTTTCTGG + Intergenic
910826930 1:91419410-91419432 CTTATGAATGTATCTCTGTCTGG + Intergenic
911464640 1:98236233-98236255 CTGATGATTGTATTTCTGTGGGG - Intergenic
911641931 1:100298721-100298743 CAGGTGATGGGATATCTGCCCGG - Intergenic
913110963 1:115656726-115656748 CTGGTGATGGCAACCCTGGCTGG + Intronic
915071970 1:153277338-153277360 CTGGTGAGGGGCTCTCTTTCTGG - Intergenic
915645653 1:157270154-157270176 CTGGTCCTGGCATCCCTGTCTGG - Intergenic
915975596 1:160385313-160385335 CTGTTGATGGTATCTCATTGTGG + Intergenic
918982637 1:191583217-191583239 CTGATGATTGTATTTCTGTGGGG + Intergenic
1064521546 10:16208301-16208323 CTGGTACTGGTATCTTTCTCTGG + Intergenic
1067020204 10:42790005-42790027 AGGGTGGTGGTTTCTCTGTCTGG + Intronic
1067499932 10:46794408-46794430 AGGGTGGTGGTTTCTCTGTCTGG + Intergenic
1067594701 10:47545917-47545939 AGGGTGGTGGTTTCTCTGTCTGG - Intronic
1067641810 10:48054032-48054054 AGGGTGGTGGTTTCTCTGTCTGG - Intergenic
1068199323 10:53762865-53762887 GTGGTGCTGGTATCTGTTTCTGG - Intergenic
1068575644 10:58681446-58681468 CTGGAGATGGTATCTCATTGTGG - Intronic
1068779668 10:60905880-60905902 CTGGTGTTTGTATCTTTGCCTGG - Intronic
1070421298 10:76239839-76239861 CTGATCATGGTAACTCTGTGAGG + Intronic
1071956353 10:90764159-90764181 CTGGAGATGGTATCTCATTGTGG + Intronic
1073002259 10:100294515-100294537 CTGGTGAGGGTCTCTCTGAGGGG - Exonic
1075852205 10:125598357-125598379 GCGGTGATGGTAACCCTGTCTGG + Intronic
1076190875 10:128482541-128482563 CTGGTGAGGGTATCTCAGAGAGG + Intergenic
1079016027 11:16869458-16869480 ATGGTGATGGTCTATCTCTCAGG + Intronic
1079237711 11:18701650-18701672 CTGGTGATGGCAGCGCTGTCGGG + Exonic
1079446525 11:20561774-20561796 CTGGTGCTGGTATCTCTGAGGGG - Intergenic
1079801909 11:24879619-24879641 CGTGAGATGGTATCTCTTTCTGG + Intronic
1079900251 11:26174215-26174237 GTGGAGATGGTATCTCAGTGTGG - Intergenic
1080057546 11:27922742-27922764 CTGTTGCTGGTACCTCTGTCGGG - Intergenic
1082036050 11:47646146-47646168 TTAGTGATGTTATCTCTGCCAGG + Intergenic
1085702557 11:78757866-78757888 CTGCTAATGGAAACTCTGTCAGG - Intronic
1085778824 11:79390250-79390272 ATGGTGCTGGTGGCTCTGTCTGG - Intronic
1086086923 11:82965036-82965058 CTGATGATTGTATTTCTGTGGGG + Intronic
1086391603 11:86370804-86370826 CTGGTTAAGTCATCTCTGTCTGG + Intergenic
1086391605 11:86370823-86370845 CTGGTGTTGGCCTCTGTGTCTGG + Intergenic
1087367331 11:97236955-97236977 CTGATGAAGGTATCACTTTCAGG + Intergenic
1087952658 11:104242566-104242588 CTGCAGATGGTAGCTCTGCCTGG - Intergenic
1088403016 11:109441862-109441884 TTGGTGATGGTTTCTTTGTGGGG - Intergenic
1090312167 11:125750637-125750659 ATGGTGCTGGTATCTCTGTGGGG + Intergenic
1094463934 12:30730241-30730263 CTTGTGGTTGTATCTCTGGCTGG + Exonic
1094766263 12:33598164-33598186 CTGGTGCTGGTATCTCTGATTGG + Intergenic
1096527760 12:52222362-52222384 CTGGTGCTGGCATCTCTGAGTGG - Intergenic
1097172539 12:57125445-57125467 CTGCTGAGGGTATGTCTGTAAGG - Intronic
1101121938 12:101591066-101591088 CTGGTGGTGGTATGTCTCTCTGG - Intronic
1103518363 12:121521790-121521812 CTTGTGATGGTGACTGTGTCTGG - Intronic
1103985940 12:124767577-124767599 CTGGTGGTGCTTTCTCTCTCTGG + Intergenic
1104264126 12:127214918-127214940 CTGGTGATTATATTTCTGTAAGG + Intergenic
1104655899 12:130573839-130573861 CTGGGGATGGGATTTCTGTGTGG - Intronic
1104981405 12:132574530-132574552 CTGGTGACGGTAGATCTGCCAGG - Exonic
1119793327 14:77373985-77374007 GTGGTGTTGGTATCTGTTTCTGG - Intronic
1121414894 14:93772639-93772661 CTGGTGAAGGTATTTCTGGAAGG - Intronic
1121439854 14:93941725-93941747 ATGGGGCTGGTATCTCTGGCAGG + Intronic
1126062754 15:44799711-44799733 CTGGTGCTGGTGTCTCTGCAGGG - Intergenic
1127816750 15:62617378-62617400 CTGGTTTTGGCATCTCAGTCTGG + Intronic
1127942563 15:63714384-63714406 CTGGTGATGCCATCTCACTCTGG - Intronic
1128126150 15:65194535-65194557 CTGCTAATGGTATGGCTGTCAGG - Intergenic
1128782683 15:70373185-70373207 CTGGTGATGGTATCTCATTCTGG - Intergenic
1134017004 16:10895671-10895693 CAGTTGATGGTGTCTGTGTCGGG - Exonic
1137627839 16:49920857-49920879 CTGGTGCTGGTACCACTGCCTGG + Intergenic
1148005417 17:44424164-44424186 CTGGAGGTGGTGTCTATGTCAGG + Intronic
1148638845 17:49169762-49169784 CTGGTTATGGTATCTATAGCAGG + Exonic
1148746339 17:49920336-49920358 CTGCTGATGGCACCCCTGTCTGG + Intergenic
1148885048 17:50766293-50766315 CAGGTTCTGGTATCTCTATCAGG - Intergenic
1149060751 17:52418885-52418907 TTGGTGATGCTATCTGTGTTAGG - Intergenic
1149069041 17:52518077-52518099 GAGGTGAAGGTATCTCTTTCTGG - Intergenic
1150174378 17:63034865-63034887 CTTGAGATGGAATCTGTGTCTGG + Intronic
1150886761 17:69095677-69095699 CTGGTGATTGAATGTCTGTCTGG - Intronic
1157373277 18:47138296-47138318 CAGGTGATGTTGTCTCTCTCAGG - Intronic
1158735794 18:60077186-60077208 CTGGTTATGGTATCCTTGGCTGG - Intergenic
1158959037 18:62572607-62572629 GTAGTGATGGTATTTCTGTTTGG + Intronic
1160464649 18:79066317-79066339 GAGGAGATGGTATCACTGTCAGG + Intergenic
1161185367 19:2915102-2915124 CTGGTGAGGGGATCTTTGTATGG - Intronic
1163818918 19:19485096-19485118 CTGCTGTTGGTCCCTCTGTCAGG + Intronic
1163970089 19:20784988-20785010 CTTCTGATGTTATCTCTATCTGG + Intronic
1164873236 19:31664404-31664426 CTGGTGCTGACATCTCTGCCAGG - Intergenic
1165641402 19:37390704-37390726 ATGGTGATGGTGTAGCTGTCAGG - Exonic
1166626593 19:44362851-44362873 CTGTTGTTGGTATGTCTTTCTGG + Intronic
1167517589 19:49932419-49932441 CAGGTGATGGCTTCTCTGACTGG + Exonic
1168189878 19:54730128-54730150 CTGGTGATGACATCTCTCTGTGG - Intronic
1168191879 19:54744428-54744450 CTGGTGATGACATCCCTGTGTGG - Intronic
1168196208 19:54775798-54775820 CTGGTGATGACATCTCTGTGTGG - Intronic
1168204569 19:54840040-54840062 CTGGTGATGACATCTCTGTGTGG - Intronic
1168209212 19:54877407-54877429 CTGATGATTGTATTTCTGTGGGG + Intronic
926150404 2:10422734-10422756 AGGGTGCTGGTATCTCTGCCTGG - Intronic
933414324 2:81966731-81966753 CTTGAGATGGTATCTATGTCTGG + Intergenic
933817382 2:86079256-86079278 CAGGTGATCGTATCTCCCTCTGG - Intronic
936929566 2:117773714-117773736 CAGGTGATGCTAACACTGTCTGG - Intergenic
938171446 2:129080309-129080331 CTGGTGGTGGAATCAGTGTCTGG + Intergenic
939279451 2:140043145-140043167 CTGGTGGTGGCATCTGTTTCTGG - Intergenic
944390451 2:199213103-199213125 GTGGTAATGGTATCTTTGCCTGG + Intergenic
945958150 2:216105488-216105510 GTGGTGATGGTATGTGTGTTGGG - Intergenic
946584171 2:221165461-221165483 CTGGTCTTGGGATCTGTGTCTGG + Intergenic
948229147 2:236336895-236336917 GTGGTGATGGTGCCTCTGTGTGG + Intronic
948292140 2:236833506-236833528 CTGCTAATGGCATCTCTGTCTGG - Intergenic
1171245964 20:23609665-23609687 CTGGTGTTGCTTTCTCTCTCAGG + Intergenic
1171354028 20:24529911-24529933 CTGGTGATGGTATCAATGGTGGG + Intronic
1175511698 20:59532477-59532499 CTGGTGTTGGTATCTCATTGTGG + Intergenic
1180092367 21:45539674-45539696 CTGGGGAGGGTCTCTCTCTCTGG - Intronic
1181840861 22:25659319-25659341 CTAGTGAAGTCATCTCTGTCTGG - Intronic
1182200374 22:28562417-28562439 CTGGTGCTGGTATTTCTGAGAGG + Intronic
950323744 3:12084028-12084050 CTGTTTATGGCATCTCTGTTAGG + Intronic
950821019 3:15758625-15758647 CTGTTCAGGGTATCTCTCTCTGG - Intronic
951260581 3:20503565-20503587 CAGGTGCTGGTATCTATGGCTGG - Intergenic
952525206 3:34202887-34202909 CTGGTGCTGGTGTCTCTGCTGGG + Intergenic
954245523 3:49328479-49328501 CTTGAGATGGAATCTATGTCTGG - Intronic
955851091 3:63220717-63220739 CTGGTGCTGGTGTCTCTGAGAGG - Intergenic
957633417 3:82748385-82748407 CGGGAGATGGTATCTCAGTGTGG - Intergenic
960790322 3:121423165-121423187 CAGGTCTTGGTATCTGTGTCAGG + Exonic
962139306 3:132771821-132771843 CTGGTGCTGGTGTCTCTGAAGGG + Intergenic
963460933 3:145614224-145614246 CTGGCGATGGTATCTCATTGTGG + Intergenic
966437231 3:179902119-179902141 CTTGTGGTGGTAACTCTGTGGGG + Intronic
966447645 3:180021191-180021213 CTAGTGATGTTCTCTCTGACCGG - Intronic
967089818 3:186125947-186125969 GTGGTGATGGTATGTTTGTGTGG + Intronic
967089851 3:186126174-186126196 GTGGTGATGGTATGTTTGTGTGG + Intronic
968654567 4:1772931-1772953 CTGGAGGTGTTATCTCTGACAGG + Intergenic
971693425 4:29867205-29867227 CTGGTGTTGGTATCTGTTTCTGG - Intergenic
976702912 4:87990589-87990611 CTTTTGATGCTATCTTTGTCTGG - Intergenic
977229982 4:94440431-94440453 TTGGAAATGGTATCTCTGGCCGG + Intergenic
978163629 4:105580038-105580060 CTGATGATTGTATTTCTGTGAGG + Intronic
981170478 4:141616932-141616954 TTCGTGATGTTCTCTCTGTCAGG + Intergenic
985899749 5:2779434-2779456 CTGGTGATGGTGTCTTTTTTGGG + Intergenic
986144464 5:5064354-5064376 CTGGTGATGGTCTCTCCATAGGG + Intergenic
989320243 5:40125778-40125800 CGTGAGATGGTATCTCTTTCTGG + Intergenic
989657133 5:43756845-43756867 CTGATGATTGTATTTCTGTGTGG + Intergenic
991517387 5:67452905-67452927 ATAGTGATGGCCTCTCTGTCTGG + Intergenic
991927469 5:71719342-71719364 CTGCTGATGCTACCTCTGTTGGG + Exonic
995804447 5:116035804-116035826 CTGCCGCTGGTATCTCTGTGGGG + Intronic
995960297 5:117830616-117830638 CTGGTGTTTGTATTTCTGTGTGG + Intergenic
996776932 5:127142844-127142866 CTGTTGATGGGTTTTCTGTCTGG + Intergenic
996781223 5:127188835-127188857 TTGGTCCAGGTATCTCTGTCTGG + Intergenic
996935525 5:128943789-128943811 CTGGCGATGGTATCTCATTGTGG + Intronic
999104571 5:149059521-149059543 CTGCTGATGGTAGGTCTGTTAGG - Intronic
1003767284 6:9253117-9253139 CTGCTGTTGGTATCTTTGTCAGG + Intergenic
1003902362 6:10666677-10666699 CTGATGATTGTATTTCTGTGGGG + Intergenic
1005186300 6:23166394-23166416 ATGGTGTTGGTGTCTGTGTCTGG - Intergenic
1007696218 6:43735916-43735938 CTGGTGATGCTGTCTGTTTCAGG - Intergenic
1009585904 6:65601436-65601458 TTGGTGCTGGTATCTCTGTGGGG - Intronic
1009657996 6:66570261-66570283 CTGGTGGTGTTATCTCTGGCAGG - Intergenic
1024298643 7:47866904-47866926 AGCGTGGTGGTATCTCTGTCTGG - Intronic
1024713318 7:52043183-52043205 GTGGTGATGGTTCCTCTGTTAGG - Intergenic
1029024162 7:97397682-97397704 CTGATGTTGGTATCTCTGAGGGG - Intergenic
1030696607 7:112591843-112591865 CTGGTGGTTGTATTTCTGTGGGG - Intergenic
1030929416 7:115503860-115503882 CTGGCAATGGTCTCTCTGTTTGG - Intergenic
1031704357 7:124962508-124962530 CTGGCCATGATGTCTCTGTCCGG - Intergenic
1034162642 7:149004438-149004460 CTTGTGATGGCCTCTCTGACAGG - Intronic
1035461119 7:159039810-159039832 CTGGTGTTCTTATTTCTGTCAGG - Intronic
1045207846 8:100061587-100061609 CTTGAGATGGTATCTCAGTGTGG - Intronic
1045673062 8:104578224-104578246 CTGATGATTGTATTTCTGTGGGG - Intronic
1047056846 8:121174405-121174427 CTGCTGCTGGTAGCTCTGTGGGG + Intergenic
1047260440 8:123253885-123253907 CTGGTGATGGCCACTGTGTCCGG + Exonic
1047867971 8:129049696-129049718 TTTGTGATGTTTTCTCTGTCAGG - Intergenic
1048506234 8:135024727-135024749 CTGTAGATGGTATCTCTGTCTGG + Intergenic
1051173238 9:14340736-14340758 CTGGTGGTGGTATTTATGCCTGG + Intronic
1052475285 9:28951545-28951567 CTGGGGGTGGCACCTCTGTCAGG - Intergenic
1053091337 9:35280359-35280381 CTGGTCAAGGTATCTCTTACTGG + Intronic
1057524747 9:95788549-95788571 CTGGTGCTGGAATCTCAGACAGG - Intergenic
1058868498 9:109182964-109182986 CTGGTGGTTGTATCTGTGCCTGG + Intronic
1059154618 9:111978790-111978812 GTGGTGATTGAATCTCTCTCAGG - Intergenic
1059353924 9:113685330-113685352 TTGGTGATGGTTTGGCTGTCAGG + Intergenic
1060140459 9:121205194-121205216 CTGGTGATGGTGTGTCTGTGGGG - Intronic
1187005606 X:15230138-15230160 CTAGGTATGGTATCTCTTTCAGG + Intergenic
1187839604 X:23473450-23473472 GTGGTGGTGGTGTCTCTGCCAGG + Intergenic
1190057552 X:47190662-47190684 CTGGGGGTGGTAGTTCTGTCTGG - Intergenic
1192296823 X:69858694-69858716 TTTTTGATGTTATCTCTGTCAGG + Intronic
1194224837 X:91244175-91244197 CAGGTGCTGGTATCAATGTCTGG - Intergenic
1198001765 X:132446455-132446477 CTGGAGATGGTATCTCATTGTGG + Intronic
1198157186 X:133972780-133972802 CTGGTGATGGTATCTCTGTCTGG - Intronic
1200561300 Y:4707485-4707507 CAGGTGCTGGTATCAATGTCTGG - Intergenic
1200827267 Y:7658214-7658236 CTGGTGGTCCTGTCTCTGTCTGG - Intergenic