ID: 1198161267

View in Genome Browser
Species Human (GRCh38)
Location X:134010970-134010992
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198161260_1198161267 1 Left 1198161260 X:134010946-134010968 CCATATTTGCTTTCCAGCACTTG No data
Right 1198161267 X:134010970-134010992 CAGAGCAGGGGGCAGGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198161267 Original CRISPR CAGAGCAGGGGGCAGGTGTC TGG Intergenic
No off target data available for this crispr