ID: 1198161267 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:134010970-134010992 |
| Sequence | CAGAGCAGGGGGCAGGTGTC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1198161260_1198161267 | 1 | Left | 1198161260 | X:134010946-134010968 | CCATATTTGCTTTCCAGCACTTG | No data | ||
| Right | 1198161267 | X:134010970-134010992 | CAGAGCAGGGGGCAGGTGTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1198161267 | Original CRISPR | CAGAGCAGGGGGCAGGTGTC TGG | Intergenic | ||
| No off target data available for this crispr | |||||