ID: 1198169999

View in Genome Browser
Species Human (GRCh38)
Location X:134096222-134096244
Sequence AGTTATCTGTGGAGGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198169999_1198170004 15 Left 1198169999 X:134096222-134096244 CCTGCCATCCTCCACAGATAACT No data
Right 1198170004 X:134096260-134096282 AATTGCTCTTGGCATGCTTCTGG No data
1198169999_1198170003 4 Left 1198169999 X:134096222-134096244 CCTGCCATCCTCCACAGATAACT No data
Right 1198170003 X:134096249-134096271 TGCTTTTGAGAAATTGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198169999 Original CRISPR AGTTATCTGTGGAGGATGGC AGG (reversed) Intergenic
No off target data available for this crispr