ID: 1198175055

View in Genome Browser
Species Human (GRCh38)
Location X:134146726-134146748
Sequence GTTGACACTCTGTCATCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198175051_1198175055 -10 Left 1198175051 X:134146713-134146735 CCACTCCCTCCTTGTTGACACTC No data
Right 1198175055 X:134146726-134146748 GTTGACACTCTGTCATCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198175055 Original CRISPR GTTGACACTCTGTCATCTCC TGG Intergenic
No off target data available for this crispr