ID: 1198175715

View in Genome Browser
Species Human (GRCh38)
Location X:134152475-134152497
Sequence TGATTTTTTGCTTGGGCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198175715_1198175723 13 Left 1198175715 X:134152475-134152497 CCACTTGCCCAAGCAAAAAATCA No data
Right 1198175723 X:134152511-134152533 CTTTACTTGCACAGGAAACCAGG No data
1198175715_1198175718 5 Left 1198175715 X:134152475-134152497 CCACTTGCCCAAGCAAAAAATCA No data
Right 1198175718 X:134152503-134152525 GACCCCTCCTTTACTTGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198175715 Original CRISPR TGATTTTTTGCTTGGGCAAG TGG (reversed) Intergenic
No off target data available for this crispr