ID: 1198175723

View in Genome Browser
Species Human (GRCh38)
Location X:134152511-134152533
Sequence CTTTACTTGCACAGGAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198175715_1198175723 13 Left 1198175715 X:134152475-134152497 CCACTTGCCCAAGCAAAAAATCA No data
Right 1198175723 X:134152511-134152533 CTTTACTTGCACAGGAAACCAGG No data
1198175716_1198175723 6 Left 1198175716 X:134152482-134152504 CCCAAGCAAAAAATCATTCTTGA No data
Right 1198175723 X:134152511-134152533 CTTTACTTGCACAGGAAACCAGG No data
1198175717_1198175723 5 Left 1198175717 X:134152483-134152505 CCAAGCAAAAAATCATTCTTGAC No data
Right 1198175723 X:134152511-134152533 CTTTACTTGCACAGGAAACCAGG No data
1198175714_1198175723 14 Left 1198175714 X:134152474-134152496 CCCACTTGCCCAAGCAAAAAATC No data
Right 1198175723 X:134152511-134152533 CTTTACTTGCACAGGAAACCAGG No data
1198175713_1198175723 24 Left 1198175713 X:134152464-134152486 CCAGCGTGAACCCACTTGCCCAA No data
Right 1198175723 X:134152511-134152533 CTTTACTTGCACAGGAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198175723 Original CRISPR CTTTACTTGCACAGGAAACC AGG Intergenic
No off target data available for this crispr