ID: 1198177592

View in Genome Browser
Species Human (GRCh38)
Location X:134172086-134172108
Sequence TCCGGTAGAGTTGACTGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198177592_1198177597 -1 Left 1198177592 X:134172086-134172108 CCCAACCAGTCAACTCTACCGGA No data
Right 1198177597 X:134172108-134172130 ATCACAGCTGCCCCAACGAAGGG No data
1198177592_1198177604 28 Left 1198177592 X:134172086-134172108 CCCAACCAGTCAACTCTACCGGA No data
Right 1198177604 X:134172137-134172159 TCTTGCCCAGCCACCCGCTCGGG No data
1198177592_1198177603 27 Left 1198177592 X:134172086-134172108 CCCAACCAGTCAACTCTACCGGA No data
Right 1198177603 X:134172136-134172158 TTCTTGCCCAGCCACCCGCTCGG No data
1198177592_1198177596 -2 Left 1198177592 X:134172086-134172108 CCCAACCAGTCAACTCTACCGGA No data
Right 1198177596 X:134172107-134172129 GATCACAGCTGCCCCAACGAAGG 0: 1
1: 0
2: 0
3: 7
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198177592 Original CRISPR TCCGGTAGAGTTGACTGGTT GGG (reversed) Intergenic