ID: 1198177594

View in Genome Browser
Species Human (GRCh38)
Location X:134172091-134172113
Sequence TGTGATCCGGTAGAGTTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198177594_1198177604 23 Left 1198177594 X:134172091-134172113 CCAGTCAACTCTACCGGATCACA No data
Right 1198177604 X:134172137-134172159 TCTTGCCCAGCCACCCGCTCGGG No data
1198177594_1198177597 -6 Left 1198177594 X:134172091-134172113 CCAGTCAACTCTACCGGATCACA No data
Right 1198177597 X:134172108-134172130 ATCACAGCTGCCCCAACGAAGGG No data
1198177594_1198177603 22 Left 1198177594 X:134172091-134172113 CCAGTCAACTCTACCGGATCACA No data
Right 1198177603 X:134172136-134172158 TTCTTGCCCAGCCACCCGCTCGG No data
1198177594_1198177596 -7 Left 1198177594 X:134172091-134172113 CCAGTCAACTCTACCGGATCACA No data
Right 1198177596 X:134172107-134172129 GATCACAGCTGCCCCAACGAAGG 0: 1
1: 0
2: 0
3: 7
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198177594 Original CRISPR TGTGATCCGGTAGAGTTGAC TGG (reversed) Intergenic