ID: 1198177595

View in Genome Browser
Species Human (GRCh38)
Location X:134172104-134172126
Sequence TCGTTGGGGCAGCTGTGATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198177595_1198177604 10 Left 1198177595 X:134172104-134172126 CCGGATCACAGCTGCCCCAACGA No data
Right 1198177604 X:134172137-134172159 TCTTGCCCAGCCACCCGCTCGGG No data
1198177595_1198177603 9 Left 1198177595 X:134172104-134172126 CCGGATCACAGCTGCCCCAACGA No data
Right 1198177603 X:134172136-134172158 TTCTTGCCCAGCCACCCGCTCGG No data
1198177595_1198177609 23 Left 1198177595 X:134172104-134172126 CCGGATCACAGCTGCCCCAACGA No data
Right 1198177609 X:134172150-134172172 CCCGCTCGGGAAACCGCGCGCGG No data
1198177595_1198177611 24 Left 1198177595 X:134172104-134172126 CCGGATCACAGCTGCCCCAACGA No data
Right 1198177611 X:134172151-134172173 CCGCTCGGGAAACCGCGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198177595 Original CRISPR TCGTTGGGGCAGCTGTGATC CGG (reversed) Intergenic