ID: 1198177599

View in Genome Browser
Species Human (GRCh38)
Location X:134172119-134172141
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198177599_1198177603 -6 Left 1198177599 X:134172119-134172141 CCCAACGAAGGGCTCCCTTCTTG No data
Right 1198177603 X:134172136-134172158 TTCTTGCCCAGCCACCCGCTCGG No data
1198177599_1198177609 8 Left 1198177599 X:134172119-134172141 CCCAACGAAGGGCTCCCTTCTTG No data
Right 1198177609 X:134172150-134172172 CCCGCTCGGGAAACCGCGCGCGG No data
1198177599_1198177611 9 Left 1198177599 X:134172119-134172141 CCCAACGAAGGGCTCCCTTCTTG No data
Right 1198177611 X:134172151-134172173 CCGCTCGGGAAACCGCGCGCGGG No data
1198177599_1198177613 21 Left 1198177599 X:134172119-134172141 CCCAACGAAGGGCTCCCTTCTTG No data
Right 1198177613 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
1198177599_1198177604 -5 Left 1198177599 X:134172119-134172141 CCCAACGAAGGGCTCCCTTCTTG No data
Right 1198177604 X:134172137-134172159 TCTTGCCCAGCCACCCGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198177599 Original CRISPR CAAGAAGGGAGCCCTTCGTT GGG (reversed) Intergenic