ID: 1198177601

View in Genome Browser
Species Human (GRCh38)
Location X:134172133-134172155
Sequence AGCGGGTGGCTGGGCAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198177601_1198177613 7 Left 1198177601 X:134172133-134172155 CCCTTCTTGCCCAGCCACCCGCT No data
Right 1198177613 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
1198177601_1198177611 -5 Left 1198177601 X:134172133-134172155 CCCTTCTTGCCCAGCCACCCGCT No data
Right 1198177611 X:134172151-134172173 CCGCTCGGGAAACCGCGCGCGGG No data
1198177601_1198177617 25 Left 1198177601 X:134172133-134172155 CCCTTCTTGCCCAGCCACCCGCT No data
Right 1198177617 X:134172181-134172203 TCCGGCCCGCCCCTCGCAGGTGG No data
1198177601_1198177609 -6 Left 1198177601 X:134172133-134172155 CCCTTCTTGCCCAGCCACCCGCT No data
Right 1198177609 X:134172150-134172172 CCCGCTCGGGAAACCGCGCGCGG No data
1198177601_1198177616 22 Left 1198177601 X:134172133-134172155 CCCTTCTTGCCCAGCCACCCGCT No data
Right 1198177616 X:134172178-134172200 AGCTCCGGCCCGCCCCTCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198177601 Original CRISPR AGCGGGTGGCTGGGCAAGAA GGG (reversed) Intergenic