ID: 1198177602

View in Genome Browser
Species Human (GRCh38)
Location X:134172134-134172156
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 415}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198177602_1198177613 6 Left 1198177602 X:134172134-134172156 CCTTCTTGCCCAGCCACCCGCTC 0: 1
1: 0
2: 0
3: 33
4: 415
Right 1198177613 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
1198177602_1198177616 21 Left 1198177602 X:134172134-134172156 CCTTCTTGCCCAGCCACCCGCTC 0: 1
1: 0
2: 0
3: 33
4: 415
Right 1198177616 X:134172178-134172200 AGCTCCGGCCCGCCCCTCGCAGG No data
1198177602_1198177617 24 Left 1198177602 X:134172134-134172156 CCTTCTTGCCCAGCCACCCGCTC 0: 1
1: 0
2: 0
3: 33
4: 415
Right 1198177617 X:134172181-134172203 TCCGGCCCGCCCCTCGCAGGTGG No data
1198177602_1198177609 -7 Left 1198177602 X:134172134-134172156 CCTTCTTGCCCAGCCACCCGCTC 0: 1
1: 0
2: 0
3: 33
4: 415
Right 1198177609 X:134172150-134172172 CCCGCTCGGGAAACCGCGCGCGG No data
1198177602_1198177611 -6 Left 1198177602 X:134172134-134172156 CCTTCTTGCCCAGCCACCCGCTC 0: 1
1: 0
2: 0
3: 33
4: 415
Right 1198177611 X:134172151-134172173 CCGCTCGGGAAACCGCGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198177602 Original CRISPR GAGCGGGTGGCTGGGCAAGA AGG (reversed) Intergenic